Construct: ORF TRCN0000477299
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013153.1_s317c1
- Derived from:
- ccsbBroadEn_03550
- DNA Barcode:
- GCCAAGGCTCCATATTCCACAATG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- BBS7 (55212)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477299
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55212 | BBS7 | Bardet-Biedl syndrome 7 | NM_018190.3 | 100% | 100% | |
| 2 | human | 55212 | BBS7 | Bardet-Biedl syndrome 7 | NM_176824.3 | 93.9% | 93.9% | 2016_2145delinsT |
| 3 | human | 55212 | BBS7 | Bardet-Biedl syndrome 7 | XM_005263106.4 | 93.8% | 93.8% | 601_603delGTA;2019_2148delinsT |
| 4 | human | 55212 | BBS7 | Bardet-Biedl syndrome 7 | XM_011532080.3 | 92% | 92% | 602_646del;2061_2190delinsT |
| 5 | human | 55212 | BBS7 | Bardet-Biedl syndrome 7 | XM_011532079.3 | 91.8% | 91.9% | 601_648del;2064_2193delinsT |
| 6 | human | 55212 | BBS7 | Bardet-Biedl syndrome 7 | XM_017008358.2 | 91.6% | 91.6% | 601_603delGTA;1510_1511ins165 |
| 7 | human | 55212 | BBS7 | Bardet-Biedl syndrome 7 | XM_017008357.2 | 86.2% | 86.2% | 1507_1508ins165;1851_1980delinsT |
| 8 | human | 55212 | BBS7 | Bardet-Biedl syndrome 7 | XM_011532081.3 | 84.3% | 84.4% | 601_648del;1555_1556ins165;1899_2028delinsT |
| 9 | mouse | 71492 | Bbs7 | Bardet-Biedl syndrome 7 (hu... | NM_027810.3 | 82.4% | 86% | (many diffs) |
| 10 | mouse | 71492 | Bbs7 | Bardet-Biedl syndrome 7 (hu... | XM_006535535.3 | 80% | 83.3% | (many diffs) |
| 11 | mouse | 71492 | Bbs7 | Bardet-Biedl syndrome 7 (hu... | XM_006535536.3 | 60.7% | 63.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2082
- ORF length:
- 2016
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga tctgatttta aaccgaatgg attatctgca ggtgggagta acatctcaga 121 agactatgaa gctaattcct gcctcaagac acagagctac acaaaaggtg gttattggag 181 atcatgatgg ggtagttatg tgctttggca tgaagaaagg agaagcagca gcagtgttca 241 agactttacc cgggccgaag attgcaaggc tggaactggg aggggttatc aacacacctc 301 aggagaaaat ttttattgct gcagcatctg agattagagg cttcacaaaa agaggaaaac 361 agttcctctc ctttgaaaca aacctcactg aaagcattaa agctatgcac atatctggct 421 cagacctctt tctcagtgca agttacatct ataaccatta ttgtgactgc aaagaccaac 481 attattacct ttctggggat aaaatcaatg atgtgatctg ccttccagtg gaaagattat 541 ctcgtatcac acctgtattg gcctgccagg acagagtgct cagagtttta cagggatctg 601 atgtgatgta tgcagttgaa gttcctggac cccctactgt cttagcacta cacaatggaa 661 atggcggtga ctctggagaa gaccttttgt ttgggacatc agacggaaaa cttgcgctta 721 tacagattac tacatccaaa ccagtacgca agtgggaaat tcaaaatgag aaaaagagag 781 gaggtatttt gtgtattgac agctttgaca ttgtgggtga tggggttaaa gatttacttg 841 ttgggagaga tgacggaatg gtggaagtgt atagttttga taatgcaaat gaacctgttc 901 tacgatttga tcagatgttg tctgaaagcg tcacatctat ccagggtggt tgtgtaggaa 961 aagacagcta tgatgaaatc gtggtgtcca catattcagg ctgggttaca ggtctgacaa 1021 cagagcccat tcataaggaa agtggaccag gagaagaact aaaaattaat caggagatgc 1081 agaataaaat ttcttcctta cggaatgagt tggaacattt gcagtataag gtattgcagg 1141 aaagagagaa ttatcaacag tcttctcaat caagcaaagc aaaatcagca gtaccttcct 1201 ttggtataaa tgataaattt acactaaata aagatgatgc cagttacagc cttatcttag 1261 aggtacagac tgcaatagat aatgtcttaa tacagagtga tgttccaata gatttacttg 1321 atgtggataa aaattctgct gttgttagct ttagcagctg tgattctgag tcaaacgaca 1381 acttccttct tgccacttat cggtgccagg cagatactac aaggctggaa ctcaagattc 1441 gctcaattga aggccagtat ggcacactac aagcatatgt gactccaaga attcaaccca 1501 aaacctgtca ggtccgccag taccacatca aacctctttc actccatcaa agaactcact 1561 ttattgatca tgacagaccc atgaatacac tgaccctaac aggccagttc agttttgctg 1621 aagttcactc ctgggtggtt ttttgtctgc ctgaagttcc agaaaaacct ccagcaggag 1681 aatgtgtgaC ATTTTACTTT CAGAACACCT TTCTAGATAC ACAACTTGAA AGTACCTACA 1741 GAAAAGGAGA GGGAGTTTTT AAATCTGACA ACATTTCTAC TATCTCCATC CTAAAAGATG 1801 TGCTTTCTAA AGAAGCTACA AAAAGGAAAA TTAACCTCAA CATATCATAC GAGATAAATG 1861 AAGTATCAGT CAAACACACT TTAAAGCTAA TCCACCCAAA GCTGGAGTAC CAGTTGCTTT 1921 TGGCTAAGAA AGTGCAGTTA ATTGATGCTT TAAAAGAATT ACAGATTCAT GAGGGAAATA 1981 CGAACTTTCT GATACCAGAA TATCACTGTA TTCTAGAAGA GGCAGATCAC CTACAGGAAG 2041 AATACAAAAA GCAACCTGCA CATCTTGAAA GACTCTATGG TTACCCAACT TTCTTGTACA 2101 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 2161 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 2221 AGGACGAGCC AAGGCTCCAT ATTCCACAAT GACGCGTTAA GTCgacaatc aacctctgga 2281 ttacaaaatt tgtgaaagat t