Transcript: Human XM_011532080.3

PREDICTED: Homo sapiens Bardet-Biedl syndrome 7 (BBS7), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BBS7 (55212)
Length:
3782
CDS:
175..2367

Additional Resources:

NCBI RefSeq record:
XM_011532080.3
NBCI Gene record:
BBS7 (55212)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532080.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419904 ACGGAATGAGTTGGAACATTT pLKO_005 1254 CDS 100% 13.200 18.480 N BBS7 n/a
2 TRCN0000249580 CAACATATCATACGAGATAAA pLKO_005 1992 CDS 100% 13.200 18.480 N Bbs7 n/a
3 TRCN0000412994 CAGTACCTTCCTTTGGTATAA pLKO_005 1343 CDS 100% 13.200 9.240 N BBS7 n/a
4 TRCN0000433048 GAAATCGTGGTGTCCACATAT pLKO_005 1129 CDS 100% 13.200 9.240 N BBS7 n/a
5 TRCN0000422639 GAACTCAAGATTCGCTCAATT pLKO_005 1582 CDS 100% 13.200 9.240 N BBS7 n/a
6 TRCN0000083779 GCAGCAGTGTTCAAGACTTTA pLKO.1 337 CDS 100% 13.200 9.240 N BBS7 n/a
7 TRCN0000083782 GCAGGAGAATGTGTGACATTT pLKO.1 1828 CDS 100% 13.200 9.240 N BBS7 n/a
8 TRCN0000413212 GGTACAGACTGCAATAGATAA pLKO_005 1416 CDS 100% 13.200 9.240 N BBS7 n/a
9 TRCN0000083780 CCTCAACATATCATACGAGAT pLKO.1 1989 CDS 100% 4.050 2.835 N BBS7 n/a
10 TRCN0000083781 CCCATGAATACACTGACCCTA pLKO.1 1732 CDS 100% 2.640 1.848 N BBS7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532080.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03550 pDONR223 100% 92% 92% None 602_646del;2061_2190delinsT n/a
2 ccsbBroad304_03550 pLX_304 0% 92% 92% V5 602_646del;2061_2190delinsT n/a
3 TRCN0000477299 GCCAAGGCTCCATATTCCACAATG pLX_317 19.7% 92% 92% V5 602_646del;2061_2190delinsT n/a
Download CSV