Transcript: Mouse XM_006535535.3

PREDICTED: Mus musculus Bardet-Biedl syndrome 7 (human) (Bbs7), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bbs7 (71492)
Length:
2636
CDS:
208..2289

Additional Resources:

NCBI RefSeq record:
XM_006535535.3
NBCI Gene record:
Bbs7 (71492)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535535.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249580 CAACATATCATACGAGATAAA pLKO_005 1914 CDS 100% 13.200 18.480 N Bbs7 n/a
2 TRCN0000249583 GAGCTCAAGATTCGTTCAATT pLKO_005 1504 CDS 100% 13.200 18.480 N Bbs7 n/a
3 TRCN0000257923 GATGGACGTCCCACATGTAAT pLKO_005 2361 3UTR 100% 13.200 10.560 N Bbs7 n/a
4 TRCN0000195852 CGAGTACCCATGAAAGTCCTT pLKO.1 2414 3UTR 100% 2.640 2.112 N Bbs7 n/a
5 TRCN0000215393 CAATAGACAATGTCCTAATAC pLKO.1 1349 CDS 100% 13.200 9.240 N Bbs7 n/a
6 TRCN0000249582 CAATAGACAATGTCCTAATAC pLKO_005 1349 CDS 100% 13.200 9.240 N Bbs7 n/a
7 TRCN0000249581 TTGCTGCAGGGTCCGAGATTA pLKO_005 392 CDS 100% 13.200 9.240 N Bbs7 n/a
8 TRCN0000179774 GAGTACCCATGAAAGTCCTTT pLKO.1 2415 3UTR 100% 4.950 3.465 N Bbs7 n/a
9 TRCN0000183268 GATCACAACATCCAAACCAAT pLKO.1 801 CDS 100% 4.950 3.465 N Bbs7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535535.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03550 pDONR223 100% 80% 83.3% None (many diffs) n/a
2 ccsbBroad304_03550 pLX_304 0% 80% 83.3% V5 (many diffs) n/a
3 TRCN0000477299 GCCAAGGCTCCATATTCCACAATG pLX_317 19.7% 80% 83.3% V5 (many diffs) n/a
Download CSV