Transcript: Human NM_001351289.2

Homo sapiens MGAT4 family member C (MGAT4C), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
MGAT4C (25834)
Length:
25364
CDS:
306..1742

Additional Resources:

NCBI RefSeq record:
NM_001351289.2
NBCI Gene record:
MGAT4C (25834)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351289.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425974 TGGACTTCTTAGCCAATTAAA pLKO_005 1731 CDS 100% 15.000 21.000 N MGAT4C n/a
2 TRCN0000424315 TTTCAGCACATGGGCTATTAT pLKO_005 1230 CDS 100% 15.000 21.000 N MGAT4C n/a
3 TRCN0000036356 CCAATCCTAGATGGCCTTAAA pLKO.1 843 CDS 100% 13.200 18.480 N MGAT4C n/a
4 TRCN0000431674 GGCTAATTATTAGGAGTATTA pLKO_005 1705 CDS 100% 13.200 18.480 N MGAT4C n/a
5 TRCN0000036354 CGCACCATATTATTGCAGGAA pLKO.1 787 CDS 100% 2.640 3.696 N MGAT4C n/a
6 TRCN0000412490 GCCAATACTTCAGACTATTAT pLKO_005 945 CDS 100% 15.000 10.500 N MGAT4C n/a
7 TRCN0000416652 ACATGCTCCAGAGGAGTATTA pLKO_005 821 CDS 100% 13.200 9.240 N MGAT4C n/a
8 TRCN0000036358 CCACCTTCAACAGGAGATGTT pLKO.1 1419 CDS 100% 4.950 3.465 N MGAT4C n/a
9 TRCN0000036355 CCTAGCAAACAAAGGAGACAA pLKO.1 1560 CDS 100% 4.950 3.465 N MGAT4C n/a
10 TRCN0000036357 GTGTCATTCTTGGGAGTTCTT pLKO.1 381 CDS 100% 4.950 3.465 N MGAT4C n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 22974 3UTR 100% 4.950 2.475 Y KAAG1 n/a
12 TRCN0000193633 CCTAGAAGGAACTTACTGGAA pLKO.1 1034 CDS 100% 2.640 1.584 N Phactr3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351289.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07949 pDONR223 100% 99.9% 99.7% None 1283C>G n/a
2 ccsbBroad304_07949 pLX_304 0% 99.9% 99.7% V5 1283C>G n/a
3 TRCN0000477425 GGGGGGGACAGCACGACATCACTG pLX_317 22.7% 99.9% 99.7% V5 1283C>G n/a
Download CSV