Transcript: Human NR_147093.2

Homo sapiens MGAT4 family member C (MGAT4C), transcript variant 11, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
MGAT4C (25834)
Length:
7003
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_147093.2
NBCI Gene record:
MGAT4C (25834)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_147093.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425974 TGGACTTCTTAGCCAATTAAA pLKO_005 997 3UTR 100% 15.000 21.000 N MGAT4C n/a
2 TRCN0000431674 GGCTAATTATTAGGAGTATTA pLKO_005 971 3UTR 100% 13.200 18.480 N MGAT4C n/a
3 TRCN0000036358 CCACCTTCAACAGGAGATGTT pLKO.1 685 3UTR 100% 4.950 3.465 N MGAT4C n/a
4 TRCN0000036355 CCTAGCAAACAAAGGAGACAA pLKO.1 826 3UTR 100% 4.950 3.465 N MGAT4C n/a
5 TRCN0000036357 GTGTCATTCTTGGGAGTTCTT pLKO.1 282 3UTR 100% 4.950 3.465 N MGAT4C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_147093.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07949 pDONR223 100% 10.4% None (many diffs) n/a
2 ccsbBroad304_07949 pLX_304 0% 10.4% V5 (many diffs) n/a
3 TRCN0000477425 GGGGGGGACAGCACGACATCACTG pLX_317 22.7% 10.4% V5 (many diffs) n/a
Download CSV