Transcript: Human NM_001282099.1

Homo sapiens Yes associated protein 1 (YAP1), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
YAP1 (10413)
Length:
5294
CDS:
389..1801

Additional Resources:

NCBI RefSeq record:
NM_001282099.1
NBCI Gene record:
YAP1 (10413)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282099.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107267 CAGGTGATACTATCAACCAAA pLKO.1 1560 CDS 100% 4.950 6.930 N YAP1 n/a
2 TRCN0000310615 CAGGTGATACTATCAACCAAA pLKO_005 1560 CDS 100% 4.950 6.930 N YAP1 n/a
3 TRCN0000107268 GACCAATAGCTCAGATCCTTT pLKO.1 1420 CDS 100% 4.950 6.930 N YAP1 n/a
4 TRCN0000300281 GACCAATAGCTCAGATCCTTT pLKO_005 1420 CDS 100% 4.950 6.930 N YAP1 n/a
5 TRCN0000107269 CGACCAATAGCTCAGATCCTT pLKO.1 1419 CDS 100% 3.000 4.200 N YAP1 n/a
6 TRCN0000095865 CCACCAAGCTAGATAAAGAAA pLKO.1 1761 CDS 100% 5.625 3.938 N Yap1 n/a
7 TRCN0000107266 GCCACCAAGCTAGATAAAGAA pLKO.1 1760 CDS 100% 5.625 3.938 N YAP1 n/a
8 TRCN0000300325 GCCACCAAGCTAGATAAAGAA pLKO_005 1760 CDS 100% 5.625 3.938 N YAP1 n/a
9 TRCN0000107265 CCCAGTTAAATGTTCACCAAT pLKO.1 2115 3UTR 100% 4.950 3.465 N YAP1 n/a
10 TRCN0000300282 CCCAGTTAAATGTTCACCAAT pLKO_005 2115 3UTR 100% 4.950 3.465 N YAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282099.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07601 pDONR223 100% 91.6% 91.5% None (many diffs) n/a
2 ccsbBroad304_07601 pLX_304 43.6% 91.6% 91.5% V5 (many diffs) n/a
3 TRCN0000477457 ACATGTTCCTATACTGTTACCAAT pLX_317 19.9% 91.6% 91.5% V5 (many diffs) n/a
Download CSV