Transcript: Human XM_017029895.1

PREDICTED: Homo sapiens transmembrane protein 164 (TMEM164), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM164 (84187)
Length:
5769
CDS:
635..1156

Additional Resources:

NCBI RefSeq record:
XM_017029895.1
NBCI Gene record:
TMEM164 (84187)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029895.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141811 GCTTTAAGTTCGCCACCAAGA pLKO.1 957 CDS 100% 4.050 2.835 N TMEM164 n/a
2 TRCN0000322569 GCTTTAAGTTCGCCACCAAGA pLKO_005 957 CDS 100% 4.050 2.835 N TMEM164 n/a
3 TRCN0000142923 CTGAGCAAGAATCTGCTCTTA pLKO.1 902 CDS 100% 0.495 0.347 N TMEM164 n/a
4 TRCN0000122341 CCTGAGCAAGAATCTGCTCTT pLKO.1 901 CDS 100% 0.405 0.284 N TMEM164 n/a
5 TRCN0000248888 CCTGGTCACCATGATGCATAT pLKO_005 1006 CDS 100% 10.800 7.560 N Tmem164 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029895.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04340 pDONR223 100% 53.2% 42.7% None (many diffs) n/a
2 ccsbBroad304_04340 pLX_304 0% 53.2% 42.7% V5 (many diffs) n/a
3 TRCN0000477463 TTTGTTTTACTGATTTTTACTAAT pLX_317 47.3% 53.2% 42.7% V5 (many diffs) n/a
Download CSV