Transcript: Mouse XM_006528779.1

PREDICTED: Mus musculus transmembrane protein 164 (Tmem164), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem164 (209497)
Length:
5235
CDS:
482..1255

Additional Resources:

NCBI RefSeq record:
XM_006528779.1
NBCI Gene record:
Tmem164 (209497)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528779.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248887 CCTGGTCACCGAAGTGAATTT pLKO_005 1045 CDS 100% 13.200 10.560 N Tmem164 n/a
2 TRCN0000248889 GTGCCAGCTCGGTAGGTATTT pLKO_005 3330 3UTR 100% 13.200 9.240 N Tmem164 n/a
3 TRCN0000144118 CCGAAGTGAATTTGAACAACA pLKO.1 1053 CDS 100% 4.950 3.465 N TMEM164 n/a
4 TRCN0000322572 CCGAAGTGAATTTGAACAACA pLKO_005 1053 CDS 100% 4.950 3.465 N TMEM164 n/a
5 TRCN0000141811 GCTTTAAGTTCGCCACCAAGA pLKO.1 801 CDS 100% 4.050 2.835 N TMEM164 n/a
6 TRCN0000322569 GCTTTAAGTTCGCCACCAAGA pLKO_005 801 CDS 100% 4.050 2.835 N TMEM164 n/a
7 TRCN0000200835 GAGATTTACTACATCCAGCAT pLKO.1 884 CDS 100% 2.640 1.848 N Tmem164 n/a
8 TRCN0000142923 CTGAGCAAGAATCTGCTCTTA pLKO.1 746 CDS 100% 0.495 0.347 N TMEM164 n/a
9 TRCN0000122341 CCTGAGCAAGAATCTGCTCTT pLKO.1 745 CDS 100% 0.405 0.284 N TMEM164 n/a
10 TRCN0000142465 GCTGGTCATCCTGTTCTCATA pLKO.1 1168 CDS 100% 4.950 2.970 N TMEM164 n/a
11 TRCN0000248888 CCTGGTCACCATGATGCATAT pLKO_005 850 CDS 100% 10.800 7.560 N Tmem164 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528779.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04340 pDONR223 100% 83.7% 82.8% None (many diffs) n/a
2 ccsbBroad304_04340 pLX_304 0% 83.7% 82.8% V5 (many diffs) n/a
3 TRCN0000477463 TTTGTTTTACTGATTTTTACTAAT pLX_317 47.3% 83.7% 82.8% V5 (many diffs) n/a
Download CSV