Construct: ORF TRCN0000477492
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016043.1_s317c1
- Derived from:
- ccsbBroadEn_13285
- DNA Barcode:
- AAGCTATCTCTCTTCCCTAAGAAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NEK10 (152110)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477492
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 152110 | NEK10 | NIMA related kinase 10 | NM_001031741.3 | 99.8% | 100% | 183C>G;846C>T |
| 2 | human | 152110 | NEK10 | NIMA related kinase 10 | NM_001304384.1 | 97.7% | 97.9% | 183C>G;846C>T;946_975del |
| 3 | human | 152110 | NEK10 | NIMA related kinase 10 | XM_024453374.1 | 55.4% | 55.2% | (many diffs) |
| 4 | human | 152110 | NEK10 | NIMA related kinase 10 | XM_017005768.1 | 41.5% | 41.3% | (many diffs) |
| 5 | human | 152110 | NEK10 | NIMA related kinase 10 | XM_017005767.2 | 40.9% | 40.7% | (many diffs) |
| 6 | human | 152110 | NEK10 | NIMA related kinase 10 | XM_024453373.1 | 40.9% | 40.7% | (many diffs) |
| 7 | human | 152110 | NEK10 | NIMA related kinase 10 | XM_006712997.3 | 40.2% | 40.1% | (many diffs) |
| 8 | human | 152110 | NEK10 | NIMA related kinase 10 | XM_017005766.2 | 40.2% | 40.1% | (many diffs) |
| 9 | human | 152110 | NEK10 | NIMA related kinase 10 | NM_152534.4 | 39.9% | 39.7% | (many diffs) |
| 10 | human | 152110 | NEK10 | NIMA related kinase 10 | XM_017005761.2 | 39.9% | 39.7% | (many diffs) |
| 11 | human | 152110 | NEK10 | NIMA related kinase 10 | XM_017005762.2 | 39.9% | 39.7% | (many diffs) |
| 12 | human | 152110 | NEK10 | NIMA related kinase 10 | XM_017005763.1 | 39.9% | 39.7% | (many diffs) |
| 13 | human | 152110 | NEK10 | NIMA related kinase 10 | XM_017005764.1 | 39.9% | 39.7% | (many diffs) |
| 14 | human | 152110 | NEK10 | NIMA related kinase 10 | XM_017005765.1 | 39.9% | 39.7% | (many diffs) |
| 15 | human | 152110 | NEK10 | NIMA related kinase 10 | XM_006712998.2 | 38.9% | 38.4% | (many diffs) |
| 16 | human | 152110 | NEK10 | NIMA related kinase 10 | XM_006712999.3 | 38.7% | 38.3% | (many diffs) |
| 17 | human | 152110 | NEK10 | NIMA related kinase 10 | XM_017005772.2 | 37.9% | 37.3% | (many diffs) |
| 18 | human | 152110 | NEK10 | NIMA related kinase 10 | XM_017005769.1 | 37% | 36.3% | (many diffs) |
| 19 | human | 152110 | NEK10 | NIMA related kinase 10 | XM_017005770.2 | 37% | 36.3% | (many diffs) |
| 20 | human | 152110 | NEK10 | NIMA related kinase 10 | XM_006713001.3 | 36.2% | 36% | (many diffs) |
| 21 | human | 152110 | NEK10 | NIMA related kinase 10 | XM_017005771.2 | 36.2% | 36% | (many diffs) |
| 22 | human | 152110 | NEK10 | NIMA related kinase 10 | XM_017005773.1 | 21.6% | 21.3% | (many diffs) |
| 23 | human | 152110 | NEK10 | NIMA related kinase 10 | XR_001740034.1 | 21.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1488
- ORF length:
- 1422
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt tcctgtacag cctgcagaac cccccgaggt actgaagagt gagccgtatg 121 gggagaaggc tgatgtctgg gcagtaggct gcatccttta tcagatggcg actttgagtc 181 cccccttcta cagcactaac atgctgtcct tggctacaaa aatagtggag gcggtatatg 241 aaccagtgcc agaaggtatc tactctgaaa aagtaacaga caccatcagc aggtgcctca 301 ctcctgatgc ggaagctcgt ccagatattg tagaagtcag ttcgatgata tcagatgtca 361 tgatgaaata tttagacaac ttatctacat cccagttgtc cttggaaaag aagctagaac 421 gggaacgaag acgcacacaa aggtatttta tggaagccaa ccggaacacc gtcacatgtc 481 accatgagct ggctgttcta tctcacgaga cctttgagaa ggcaagtttg agtagcagca 541 gcagtggagc agccagcctg aaaagtgaac tttcagaaag cgcagacctg ccccctgaag 601 gcttccaggc ctcctatggt aaagacgaag acagggcctg tgacgaaatc ctgtcagatg 661 ataacttcaa cctggaaaat gctgagaaag atacatattc agaggtagat gatgaattgg 721 acatttcgga taactccagc agctccagtt caagccctct gaaagaatct acattcaaca 781 ttttaaagag aagttttagt gcttcaggag gagaaagaca atcccaaaca agggacttca 841 ctggaggaac aggatcaaga ccaagaccag ctttgctgcc tcttgacctg cttctgaaag 901 tgccacccca tatgctcagg gcccacatta aggaaataga ggctgagtta gtgacagggt 961 ggcagtccca tagccttcct gctgtgattc ttcgaaatct caaagatcat gcatcagcag 1021 gaattgctgt gtcccagagg aaagtgcgtc agatcagtga tcctattcag cagatattaa 1081 ttcagctgca caaaataatc tatatcacac agcttcctcc agctttgcac cacaatttga 1141 aaagaagggt tatagagaga ttcaagaaat ccctcttcag ccagcagagt aacccttgta 1201 attTGAAATC TGAAATTAAA AAGTTATCTC AGGGATCTCC AGAACCGATT GAGCCCAACT 1261 TTTTCACAGC AGATTACCAT TTATTACATC GTTCATCCGG TGGAAACAGC CTGTCCCCAA 1321 ATGACCCTAC AGGTTTACCA ACCAGCATTG AATTGGAGGA AGGAATAACA TATGAACAGA 1381 TGCAGACTGT GATTGAAGAA GTCCTTGAGG AAAGTGGCTA TTACAATTTT ACATCTAACA 1441 GGTATCATTC CTATCCATGG GGGACCAAGA ATCACCCAAC CAAAAGATGC CCAACTTTCT 1501 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1561 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1621 GTGGAAAGGA CGAAAGCTAT CTCTCTTCCC TAAGAAGACG CGTTAAGTCg acaatcaacc 1681 tctggattac aaaatttgtg aaagatt