Transcript: Human XM_017005762.2

PREDICTED: Homo sapiens NIMA related kinase 10 (NEK10), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NEK10 (152110)
Length:
7841
CDS:
387..3905

Additional Resources:

NCBI RefSeq record:
XM_017005762.2
NBCI Gene record:
NEK10 (152110)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005762.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002287 CACAGCAGATTACCATTTATT pLKO.1 3680 CDS 100% 15.000 21.000 N NEK10 n/a
2 TRCN0000196316 GAATTGGACATTTCGGATAAC pLKO.1 3099 CDS 100% 10.800 15.120 N NEK10 n/a
3 TRCN0000195225 CTGACACCAAACAACATTATG pLKO.1 2352 CDS 100% 13.200 10.560 N NEK10 n/a
4 TRCN0000195038 CTTTATCAGATGGCGACTTTG pLKO.1 2541 CDS 100% 10.800 8.640 N NEK10 n/a
5 TRCN0000002290 GCTCGTCCAGATATTGTAGAA pLKO.1 2700 CDS 100% 4.950 3.960 N NEK10 n/a
6 TRCN0000002289 CATTGCCAGAACACATTATAT pLKO.1 4099 3UTR 100% 15.000 10.500 N NEK10 n/a
7 TRCN0000002291 GCAGAGTAACCCTTGTAATTT pLKO.1 3599 CDS 100% 15.000 10.500 N NEK10 n/a
8 TRCN0000195480 CCCTTCTACAGCACTAACATG pLKO.1 2568 CDS 100% 4.950 3.465 N NEK10 n/a
9 TRCN0000196372 GCTGTGATTCTTCGAAATCTC pLKO.1 3366 CDS 100% 4.950 3.465 N NEK10 n/a
10 TRCN0000196534 GCTTAGCTCTTCGATACTTAC pLKO.1 2302 CDS 100% 10.800 6.480 N NEK10 n/a
11 TRCN0000002288 CCTCTTGACCTGCTTCTGAAA pLKO.1 3264 CDS 100% 4.950 2.970 N NEK10 n/a
12 TRCN0000027639 GTCCAGATATTGTAGAAGTTA pLKO.1 2704 CDS 100% 5.625 3.938 N Nek10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005762.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13285 pDONR223 100% 39.9% 39.7% None (many diffs) n/a
2 ccsbBroad304_13285 pLX_304 0% 39.9% 39.7% V5 (many diffs) n/a
3 TRCN0000477492 AAGCTATCTCTCTTCCCTAAGAAG pLX_317 20.4% 39.9% 39.7% V5 (many diffs) n/a
4 ccsbBroadEn_15268 pDONR223 100% 35.7% 14% None (many diffs) n/a
5 ccsbBroad304_15268 pLX_304 0% 35.7% 14% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000468798 TCTAGAATGAACCAGTCTGATATC pLX_317 25% 35.7% 14% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV