Construct: ORF TRCN0000477508
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008240.1_s317c1
- Derived from:
- ccsbBroadEn_01600
- DNA Barcode:
- AGCTCTGTATGCGTACGATAACAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SSRP1 (6749)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477508
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6749 | SSRP1 | structure specific recognit... | NM_003146.3 | 100% | 100% | |
| 2 | human | 6749 | SSRP1 | structure specific recognit... | XM_024448665.1 | 88.1% | 88.1% | 346_630del |
| 3 | human | 6749 | SSRP1 | structure specific recognit... | XM_024448666.1 | 88.1% | 88.1% | 346_630del |
| 4 | human | 6749 | SSRP1 | structure specific recognit... | XM_017018180.1 | 84.1% | 84.1% | 1_402del |
| 5 | human | 6749 | SSRP1 | structure specific recognit... | XM_024448664.1 | 75.5% | 75.5% | 1_402del;748_1032del |
| 6 | human | 6749 | SSRP1 | structure specific recognit... | XM_024448667.1 | 48.6% | 45.3% | (many diffs) |
| 7 | mouse | 20833 | Ssrp1 | structure specific recognit... | NM_001136081.2 | 89.4% | 97.6% | (many diffs) |
| 8 | mouse | 20833 | Ssrp1 | structure specific recognit... | NM_182990.4 | 89.4% | 97.6% | (many diffs) |
| 9 | mouse | 20833 | Ssrp1 | structure specific recognit... | XM_006499070.1 | 89.4% | 97.6% | (many diffs) |
| 10 | mouse | 20833 | Ssrp1 | structure specific recognit... | XM_011239405.1 | 55.8% | 60.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2193
- ORF length:
- 2127
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc agagacactg gagttcaacg acgtctatca ggaggtgaaa ggttccatga 121 atgatggtcg actgaggttg agccgtcagg gcatcatctt caagaatagc aagacaggca 181 aagtggacaa catccaggct ggggagttaa cagaaggtat ctggcgccgt gttgctctgg 241 gccatggact taaactgctt acaaagaatg gccatgtcta caagtatgat ggcttccgag 301 aatcggagtt tgagaaactc tctgatttct tcaaaactca ctatcgcctt gagctaatgg 361 agaaggacct ttgtgtgaag ggctggaact gggggacagt gaaatttggt gggcagctgc 421 tttcctttga cattggtgac cagccagtct ttgagatacc cctcagcaat gtgtcccagt 481 gcaccacagg caagaatgag gtgacactgg aattccacca aaacgatgac gcagaggtgt 541 ctctcatgga ggtgcgcttc tacgtcccac ccacccagga ggatggtgtg gaccctgttg 601 aggcctttgc ccagaatgtg ttgtcaaagg cggatgtaat ccaggccacg ggagatgcca 661 tctgcatctt ccgggagctg cagtgtctga ctcctcgtgg tcgttatgac attcggatct 721 accccacctt tctgcacctg catggcaaga cctttgacta caagatcccc tacaccacag 781 tactgcgtct gtttttgtta ccccacaagg accagcgcca gatgttcttt gtgatcagcc 841 tggatccccc aatcaagcaa ggccaaactc gctaccactt cctgatcctc ctcttctcca 901 aggacgagga catttcgttg actctgaaca tgaacgagga agaagtggag aagcgctttg 961 agggtcggct caccaagaac atgtcaggat ccctctatga gatggtcagc cgggtcatga 1021 aagcactggt aaaccgcaag atcacagtgc caggcaactt ccaagggcac tcaggggccc 1081 agtgcattac ctgttcctac aaggcaagct caggactgct ctacccgctg gagcggggct 1141 tcatctacgt ccacaagcca cctgtgcaca tccgcttcga tgagatctcc tttgtcaact 1201 ttgctcgtgg taccactact actcgttcct ttgactttga aattgagacc aagcagggca 1261 ctcagtatac cttcagcagc attgagaggg aggagtacgg gaaactgttt gattttgtca 1321 acgcgaaaaa gctcaacatc aaaaaccgag gattgaaaga gggcatgaac ccaagctacg 1381 atgaatatgc tgactctgat gaggaccagc atgatgccta cttggagagg atgaaggagg 1441 aaggcaagat ccgggaggag aatgccaatg acagcagcga tgactcagga gaagaaaccg 1501 atgagtcatt caacccaggt gaagaggagg aagatgtggc agaggagttt gacagcaacg 1561 cctctgccag ctcctccagt aatgagggtg acagtgaccg ggatgagaag aagcggaaac 1621 agctcaaaaa ggccaagatg gccaaggacc gcaagagccg caagaagcct gtggaggtga 1681 agaagggcaa agaccccaat gcccccaaga ggcccatgtc tgcatacatg ctgtggctca 1741 atgccagccg agagaagatc aagtcagacc atcctGGCAT CAGCATCACG GATCTTTCCA 1801 AGAAGGCAGG CGAGATCTGG AAGGGAATGT CCAAAGAGAA GAAAGAGGAG TGGGATCGCA 1861 AGGCTGAGGA TGCCAGGAGG GACTATGAAA AAGCCATGAA AGAATATGAA GGGGGCCGAG 1921 GCGAGTCTTC TAAGAGGGAC AAGTCAAAGA AGAAGAAGAA AGTAAAGGTA AAGATGGAAA 1981 AGAAATCCAC GCCCTCTAGG GGCTCATCAT CCAAGTCGTC CTCAAGGCAG CTAAGCGAGA 2041 GCTTCAAGAG CAAAGAGTTT GTGTCTAGTG ATGAGAGCTC TTCGGGAGAG AACAAGAGCA 2101 AAAAGAAGAG GAGGAGGAGC GAGGACTCTG AAGAAGAAGA ACTAGCCAGT ACTCCCCCCA 2161 GCTCAGAGGA CTCAGCGTCA GGATCCGATG AGTACCCAAC TTTCTTGTAC AAAGTGGTTG 2221 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 2281 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAAG 2341 CTCTGTATGC GTACGATAAC AAACGCGTTA AGTCgacaat caacctctgg attacaaaat 2401 ttgtgaaaga tt