Transcript: Mouse NM_001136081.2

Mus musculus structure specific recognition protein 1 (Ssrp1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Ssrp1 (20833)
Length:
2729
CDS:
203..2329

Additional Resources:

NCBI RefSeq record:
NM_001136081.2
NBCI Gene record:
Ssrp1 (20833)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001136081.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054571 CCGTCAGGGTATCATCTTTAA pLKO.1 280 CDS 100% 13.200 18.480 N Ssrp1 n/a
2 TRCN0000301240 CCGTCAGGGTATCATCTTTAA pLKO_005 280 CDS 100% 13.200 18.480 N Ssrp1 n/a
3 TRCN0000054568 CCAGTGTATTACCTGCTCCTA pLKO.1 1216 CDS 100% 2.640 3.696 N Ssrp1 n/a
4 TRCN0000301161 CCAGTGTATTACCTGCTCCTA pLKO_005 1216 CDS 100% 2.640 3.696 N Ssrp1 n/a
5 TRCN0000054570 GCGTACATGCTGTGGCTTAAT pLKO.1 1859 CDS 100% 13.200 9.240 N Ssrp1 n/a
6 TRCN0000301237 GCGTACATGCTGTGGCTTAAT pLKO_005 1859 CDS 100% 13.200 9.240 N Ssrp1 n/a
7 TRCN0000054569 GCAGAGGAGTTTGACAGCAAT pLKO.1 1676 CDS 100% 4.950 3.465 N Ssrp1 n/a
8 TRCN0000301238 GCAGAGGAGTTTGACAGCAAT pLKO_005 1676 CDS 100% 4.950 3.465 N Ssrp1 n/a
9 TRCN0000019271 GCATGGCAAGACCTTTGACTA pLKO.1 877 CDS 100% 4.950 3.465 N SSRP1 n/a
10 TRCN0000343970 GCATGGCAAGACCTTTGACTA pLKO_005 877 CDS 100% 4.950 3.465 N SSRP1 n/a
11 TRCN0000054572 CCTACCTTTCTACACCTGCAT pLKO.1 860 CDS 100% 2.640 1.848 N Ssrp1 n/a
12 TRCN0000301162 CCTACCTTTCTACACCTGCAT pLKO_005 860 CDS 100% 2.640 1.848 N Ssrp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001136081.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01600 pDONR223 100% 89.4% 97.6% None (many diffs) n/a
2 ccsbBroad304_01600 pLX_304 0% 89.4% 97.6% V5 (many diffs) n/a
3 TRCN0000477508 AGCTCTGTATGCGTACGATAACAA pLX_317 19.9% 89.4% 97.6% V5 (many diffs) n/a
Download CSV