Construct: ORF TRCN0000477540
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008619.1_s317c1
- Derived from:
- ccsbBroadEn_03429
- DNA Barcode:
- CCCATTTGTTGACTAATATGTACC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MTRF1L (54516)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477540
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54516 | MTRF1L | mitochondrial translational... | NM_001114184.3 | 100% | 100% | |
| 2 | human | 54516 | MTRF1L | mitochondrial translational... | NM_001301047.3 | 86.7% | 86.7% | 413_414ins108 |
| 3 | human | 54516 | MTRF1L | mitochondrial translational... | NM_019041.7 | 71.1% | 70.5% | 806_808delGTGinsA;812_816delTTTCT;820_1140delinsG |
| 4 | human | 54516 | MTRF1L | mitochondrial translational... | NM_001301870.2 | 61.6% | 61% | (many diffs) |
| 5 | human | 54516 | MTRF1L | mitochondrial translational... | NM_001301872.1 | 43.6% | 41.6% | (many diffs) |
| 6 | human | 54516 | MTRF1L | mitochondrial translational... | NM_001301871.2 | 33.7% | 33.1% | (many diffs) |
| 7 | human | 54516 | MTRF1L | mitochondrial translational... | XR_245540.4 | 30.6% | 1_41del;845_846insGATT;851_2639del | |
| 8 | human | 54516 | MTRF1L | mitochondrial translational... | NR_126056.2 | 22.1% | 1_24del;359_360ins25;813_3538del | |
| 9 | human | 54516 | MTRF1L | mitochondrial translational... | XR_001743474.2 | 20.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 879
- ORF length:
- 813
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcg gtcccgggtt ctgtggggcg ctgcccggtg gctctggccc cgccgggccg 121 ttggcccagc ccgccggccc ctgagctccg gtagcccgcc gctggaggag ctgttcaccc 181 ggggcgggcc cttgcggacc ttcctcgagc gccaggcggg gtctgaagcc catttgaagg 241 tcaggaggcc cgagttgctg gcggtgatca aactgctgaa cgagaaggag cgggagctgc 301 gggagactga gcacttgctg cacgatgaga atgaagattt aaggaaactt gcagagaatg 361 aaatcacttt gtgtcaaaaa gaaataactc agctgaagca tcagattatc ttacttttgg 421 ttcccTCAGA AGAAACAGAT GAAAATGATT TGATCCTGGA AGTAACTGCA GGAGTTGGAG 481 GTCAGGAGGC AATGTTGTTT ACATCAGAGA TATTTGATAT GTATCAGCAA TATGCTGCAT 541 TTAAAAGATG GCATTTTGAA ACCCTGGAAT ATTTTCCAAG TGAACTAGGT GGCCTTAGAC 601 ATGCATCTGC CAGCATTGGG GGTTCAGAAG CCTATAGGCA CATGAAATTT GAAGGAGGTG 661 TTCACAGAGT ACAAAGAGTG CCAAAGACAG AAAAGCAAGG CCGCGTCCAT ACTAGCACCA 721 TGACTGTAGC AATATTACCC CAGCCTACTG AGATTAATCT GGTGATTAAT CCGAAAGATT 781 TGAGAATTGA CACTAAGCGA GCCAGTGGAG CTGGGGGGCA GCATGTAAAT ACCACGGACA 841 GTGCTGTCCG GATAGTTCAT CTTCCAACAG ATTGGAAGTA CCCAACTTTC TTGTACAAAG 901 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 961 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1021 ACGACCCATT TGTTGACTAA TATGTACCAC GCGTTAAGTC gacaatcaac ctctggatta 1081 caaaatttgt gaaagatt