Transcript: Human XR_001743474.2

PREDICTED: Homo sapiens mitochondrial translational release factor 1 like (MTRF1L), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MTRF1L (54516)
Length:
3872
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001743474.2
NBCI Gene record:
MTRF1L (54516)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001743474.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230940 TTGAAGGAATACGCCGATTAT pLKO_005 2456 3UTR 100% 13.200 18.480 N MTRF1L n/a
2 TRCN0000219035 GCCTATAGGCACATGAAATTT pLKO_005 1839 3UTR 100% 15.000 12.000 N MTRF1L n/a
3 TRCN0000183900 CGGGTCACAGATCACAGAATA pLKO.1 2366 3UTR 100% 13.200 9.240 N MTRF1L n/a
4 TRCN0000149053 GCACGATGAGAATGAAGATTT pLKO.1 1009 3UTR 100% 13.200 9.240 N MTRF1L n/a
5 TRCN0000230939 AGGTGTTCACAGAGTACAAAG pLKO_005 1865 3UTR 100% 10.800 7.560 N MTRF1L n/a
6 TRCN0000230938 AGTTGCTGGCGGTGATCAAAC pLKO_005 942 3UTR 100% 10.800 7.560 N MTRF1L n/a
7 TRCN0000179024 CGCTGCATGATCTTGAAACTT pLKO.1 2394 3UTR 100% 5.625 3.938 N MTRF1L n/a
8 TRCN0000149468 GCATGCATCTAGAAGAAGAAA pLKO.1 2259 3UTR 100% 5.625 3.938 N MTRF1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001743474.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08390 pDONR223 100% 29.3% None (many diffs) n/a
2 ccsbBroad304_08390 pLX_304 0% 29.3% V5 (many diffs) n/a
3 TRCN0000472764 GGGACTAAAAAAGCTGTCGCCACC pLX_317 35.1% 29.3% V5 (many diffs) n/a
4 ccsbBroadEn_03429 pDONR223 100% 20.7% None (many diffs) n/a
5 ccsbBroad304_03429 pLX_304 0% 20.7% V5 (many diffs) n/a
6 TRCN0000477540 CCCATTTGTTGACTAATATGTACC pLX_317 55.7% 20.7% V5 (many diffs) n/a
Download CSV