Transcript: Human NM_001301872.1

Homo sapiens mitochondrial translational release factor 1 like (MTRF1L), transcript variant 6, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
MTRF1L (54516)
Length:
733
CDS:
131..493

Additional Resources:

NCBI RefSeq record:
NM_001301872.1
NBCI Gene record:
MTRF1L (54516)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001301872.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149053 GCACGATGAGAATGAAGATTT pLKO.1 385 CDS 100% 13.200 9.240 N MTRF1L n/a
2 TRCN0000230938 AGTTGCTGGCGGTGATCAAAC pLKO_005 318 CDS 100% 10.800 7.560 N MTRF1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001301872.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03429 pDONR223 100% 43.6% 41.6% None (many diffs) n/a
2 ccsbBroad304_03429 pLX_304 0% 43.6% 41.6% V5 (many diffs) n/a
3 TRCN0000477540 CCCATTTGTTGACTAATATGTACC pLX_317 55.7% 43.6% 41.6% V5 (many diffs) n/a
4 ccsbBroadEn_08390 pDONR223 100% 30.9% 29.2% None (many diffs) n/a
5 ccsbBroad304_08390 pLX_304 0% 30.9% 29.2% V5 (many diffs) n/a
6 TRCN0000472764 GGGACTAAAAAAGCTGTCGCCACC pLX_317 35.1% 30.9% 29.2% V5 (many diffs) n/a
Download CSV