Construct: ORF TRCN0000477715
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001410.1_s317c1
- Derived from:
- ccsbBroadEn_13449
- DNA Barcode:
- GGAATGATAATTCGAGGGAACCAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RICTOR (253260)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477715
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 253260 | RICTOR | RPTOR independent companion... | XM_006714463.3 | 15.7% | 15% | (many diffs) |
| 2 | human | 253260 | RICTOR | RPTOR independent companion... | XM_011514005.2 | 15.4% | 14.8% | (many diffs) |
| 3 | human | 253260 | RICTOR | RPTOR independent companion... | NM_152756.5 | 15.3% | 14.7% | (many diffs) |
| 4 | human | 253260 | RICTOR | RPTOR independent companion... | NM_001285439.2 | 15.1% | 14.5% | (many diffs) |
| 5 | human | 253260 | RICTOR | RPTOR independent companion... | XM_017009312.1 | 14.4% | 13.7% | (many diffs) |
| 6 | human | 253260 | RICTOR | RPTOR independent companion... | XM_017009311.1 | 14.2% | 13.6% | (many diffs) |
| 7 | human | 253260 | RICTOR | RPTOR independent companion... | XM_017009313.1 | 12% | 11.4% | (many diffs) |
| 8 | human | 253260 | RICTOR | RPTOR independent companion... | XM_011514006.3 | 11.4% | 10.7% | (many diffs) |
| 9 | mouse | 78757 | Rictor | RPTOR independent companion... | XM_006520004.3 | 18.7% | 19.3% | (many diffs) |
| 10 | mouse | 78757 | Rictor | RPTOR independent companion... | NM_030168.3 | 14% | 14.4% | (many diffs) |
| 11 | mouse | 78757 | Rictor | RPTOR independent companion... | XM_006520003.1 | 13.8% | 14.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 861
- ORF length:
- 795
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggcgatcggc cgcggccgct ctctgaagaa cctccgagta cgagggcgga 121 atgacagcgg cgaggagaac gtcccgctgg atctgacccg agaaccttct gataacttaa 181 gagagattct ccaaaatgtg gccagattgc agggagtatc aaatatgaga aagctaggcc 241 atctgaataa ctttactaag cttctttgtg atattggcca cagtgaagaa aaactgggct 301 ttcactatga ggatatcata atttgtttgc ggttagcttt attaaatgaa gcaaaagaag 361 tgcgagcagc agggctacga gcgcttcgat atctcatcca agactccagt attcTCCAGA 421 AGGTGCTAAA ATTGAAAGTG GACTATTTAA TAGCTAGGTG CATTGACATA CAACAGAGCA 481 ACGAGGTAGA GAGGACACAA GCACTTCGAT TAGTCAGAAA GATGATTACT GTGAATGCTT 541 CCTTGTTTCC TAGTTCTGTG ACCAACTCAT TAATTGCAGT TGGAAATGAT GGACTTCAAG 601 AAAGAGACAG AATGGTCCGA GCATGCATTG CCATTATCTG TGAACTAGCA CTTCAGAATC 661 CAGAGGTGGT GGCCCTTCGA GGTGGACTAA ACACCATCTT GAAAAATGTG ATCGATTGCC 721 AATTAAGTCG AATAAATGAG GCCCTAATTA CTACAATTTT GCACCTTCTT AATCATCCAA 781 AGACTCGACA GTATGTGCGA GCTGATGTAG AATTAGAGGT AGGAACTTTA ATATTCTTTT 841 CTAGTTTTAA AATATTATTA TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 901 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 961 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAGGAA TGATAATTCG 1021 AGGGAACCAG ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt