Transcript: Mouse XM_006520003.1

PREDICTED: Mus musculus RPTOR independent companion of MTOR, complex 2 (Rictor), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rictor (78757)
Length:
9418
CDS:
55..5253

Additional Resources:

NCBI RefSeq record:
XM_006520003.1
NBCI Gene record:
Rictor (78757)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520003.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123395 CGGTTCATACAAGAGTTATTT pLKO.1 5137 CDS 100% 15.000 21.000 N Rictor n/a
2 TRCN0000123394 CGAGACTTTGTCTGTCTAATT pLKO.1 6346 3UTR 100% 13.200 9.240 N Rictor n/a
3 TRCN0000123398 GCGGTTCATACAAGAGTTATT pLKO.1 5136 CDS 100% 13.200 9.240 N Rictor n/a
4 TRCN0000123396 GCCAGTAAGATGGGAATCATT pLKO.1 901 CDS 100% 5.625 3.938 N Rictor n/a
5 TRCN0000123397 GCCATCTGAATAACTTCACTA pLKO.1 227 CDS 100% 4.950 3.465 N Rictor n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520003.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13449 pDONR223 100% 13.8% 14.2% None (many diffs) n/a
2 TRCN0000477715 GGAATGATAATTCGAGGGAACCAG pLX_317 56% 13.8% 14.2% V5 (many diffs) n/a
3 ccsbBroad304_13449 pLX_304 83.7% 13.8% 2.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV