Construct: ORF TRCN0000477721
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013901.1_s317c1
- Derived from:
- ccsbBroadEn_09716
- DNA Barcode:
- GGCTGGCTCGGTGGCCAAATAACA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LINGO2 (158038)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477721
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 158038 | LINGO2 | leucine rich repeat and Ig ... | NM_001258282.3 | 99.9% | 100% | 312C>G |
2 | human | 158038 | LINGO2 | leucine rich repeat and Ig ... | NM_001354574.2 | 99.9% | 100% | 312C>G |
3 | human | 158038 | LINGO2 | leucine rich repeat and Ig ... | NM_001354575.2 | 99.9% | 100% | 312C>G |
4 | human | 158038 | LINGO2 | leucine rich repeat and Ig ... | NM_152570.3 | 99.9% | 100% | 312C>G |
5 | human | 158038 | LINGO2 | leucine rich repeat and Ig ... | XM_011517724.2 | 99.9% | 100% | 312C>G |
6 | human | 158038 | LINGO2 | leucine rich repeat and Ig ... | XM_011517728.2 | 99.9% | 100% | 312C>G |
7 | human | 158038 | LINGO2 | leucine rich repeat and Ig ... | XM_017014303.2 | 99.9% | 100% | 312C>G |
8 | human | 158038 | LINGO2 | leucine rich repeat and Ig ... | XM_017014304.1 | 99.9% | 100% | 312C>G |
9 | human | 158038 | LINGO2 | leucine rich repeat and Ig ... | XM_017014305.1 | 99.9% | 100% | 312C>G |
10 | human | 158038 | LINGO2 | leucine rich repeat and Ig ... | XM_017014306.2 | 99.9% | 100% | 312C>G |
11 | human | 158038 | LINGO2 | leucine rich repeat and Ig ... | XM_017014307.1 | 99.9% | 100% | 312C>G |
12 | human | 158038 | LINGO2 | leucine rich repeat and Ig ... | XR_001746186.2 | 14.4% | 1_2553del;2865C>G;4372_12580del | |
13 | mouse | 242384 | Lingo2 | leucine rich repeat and Ig ... | NM_001165999.1 | 91.6% | 97.6% | (many diffs) |
14 | mouse | 242384 | Lingo2 | leucine rich repeat and Ig ... | NM_001166000.1 | 91.6% | 97.6% | (many diffs) |
15 | mouse | 242384 | Lingo2 | leucine rich repeat and Ig ... | NM_001166001.1 | 91.6% | 97.6% | (many diffs) |
16 | mouse | 242384 | Lingo2 | leucine rich repeat and Ig ... | NM_175516.4 | 91.6% | 97.6% | (many diffs) |
17 | mouse | 242384 | Lingo2 | leucine rich repeat and Ig ... | XM_006537902.2 | 91.6% | 97.6% | (many diffs) |
18 | mouse | 242384 | Lingo2 | leucine rich repeat and Ig ... | XM_006537903.2 | 91.6% | 97.6% | (many diffs) |
19 | mouse | 242384 | Lingo2 | leucine rich repeat and Ig ... | XM_006537904.3 | 91.6% | 97.6% | (many diffs) |
20 | mouse | 242384 | Lingo2 | leucine rich repeat and Ig ... | XM_011250017.2 | 91.6% | 97.6% | (many diffs) |
21 | mouse | 242384 | Lingo2 | leucine rich repeat and Ig ... | XM_011250018.2 | 91.6% | 97.6% | (many diffs) |
22 | mouse | 242384 | Lingo2 | leucine rich repeat and Ig ... | XM_011250019.2 | 91.6% | 97.6% | (many diffs) |
23 | mouse | 242384 | Lingo2 | leucine rich repeat and Ig ... | XM_011250020.2 | 91.6% | 97.6% | (many diffs) |
24 | mouse | 242384 | Lingo2 | leucine rich repeat and Ig ... | XM_011250022.2 | 91.6% | 97.6% | (many diffs) |
25 | mouse | 242384 | Lingo2 | leucine rich repeat and Ig ... | XM_011250023.2 | 91.6% | 97.6% | (many diffs) |
26 | mouse | 242384 | Lingo2 | leucine rich repeat and Ig ... | XM_011250025.2 | 91.6% | 97.6% | (many diffs) |
27 | mouse | 242384 | Lingo2 | leucine rich repeat and Ig ... | XM_011250026.2 | 91.6% | 97.6% | (many diffs) |
28 | mouse | 242384 | Lingo2 | leucine rich repeat and Ig ... | XM_017320195.1 | 91.6% | 97.6% | (many diffs) |
29 | mouse | 242384 | Lingo2 | leucine rich repeat and Ig ... | XM_017320196.1 | 91.6% | 97.6% | (many diffs) |
30 | mouse | 242384 | Lingo2 | leucine rich repeat and Ig ... | XM_017320197.1 | 91.6% | 97.6% | (many diffs) |
31 | mouse | 242384 | Lingo2 | leucine rich repeat and Ig ... | XM_017320198.1 | 91.6% | 97.6% | (many diffs) |
32 | mouse | 242384 | Lingo2 | leucine rich repeat and Ig ... | XR_001784140.1 | 15.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1887
- ORF length:
- 1818
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gcttcacacg gccatatcat gctggcagcc attcctgggt ctggctgtgg 121 tgttaatctt catgggatcc accattggct gccccgctcg ctgtgagtgc tctgcccaga 181 acaaatctgt tagctgtcac agaaggcgat tgatcgccat cccagagggc attcccatcg 241 aaaccaaaat cttggacctc agtaaaaaca ggctaaaaag cgtcaaccct gaagaattca 301 tatcatatcc tctgctggaa gagatagact tgagtgacaa catcattgcc aatgtggaac 361 caggagcatt caacaatctg tttaacctgc gttccctccg cctaaaaggc aatcgtctaa 421 agctggtccc tttgggagta ttcacggggc tgtccaatct cactaagctt gacattagtg 481 agaataagat tgtcatttta ctagactaca tgttccaaga tctacataac ctgaagtctc 541 tagaagtggg ggacaatgat ttggtttata tatcacacag ggcattcagt gggcttctta 601 gcttggagca gctcaccctg gagaaatgca acttaacagc agtaccaaca gaagccctct 661 cccacctccg cagcctcatc agcctgcatc tgaagcatct caatatcaac aatatgcctg 721 tgtatgcctt taaaagattg ttccacctga aacacctaga gattgactat tggcctttac 781 tggatatgat gcctgccaat agcctctacg gtctcaacct cacatccctt tcagtcacca 841 acaccaatct gtctactgta cccttccttg cctttaaaca cctggtatac ctgactcacc 901 ttaacctctc ctacaatccc atcagcacta ttgaagcagg catgttctct gacctgatcc 961 gccttcagga gcttcatata gtgggggccc agcttcgcac cattgagcct cactccttcc 1021 aagggctccg cttcctacgc gtgctcaatg tgtctcagaa cctgctggaa actttggaag 1081 agaatgtctt ctcctcccct agggctctgg aggtcttgag cattaacaac aaccctctgg 1141 cctgtgactg ccgccttctc tggatcttgc agcgacagcc caccctgcag tttggtggcc 1201 agcaacctat gtgtgctggc ccagacacca tccgtgagag gtctttcaag gatttccata 1261 gcactgccct ttctttttac tttacctgca aaaaacccaa aatccgtgaa aagaagttgc 1321 agcatctgct agtagatgaa gggcagacag tccagctaga atgcagtgca gatggagacc 1381 cgcagcctgt gatttcctgg gtgacacccc gaaggcgttt catcaccacc aagtccaatg 1441 gaagagccac cgtgttgggt gatggcacct tggaaatccg ctttgcccag gatcaagaca 1501 gcgggatgta tgtttgcatc gctagcaatg ctgctgggaa tgataccTTC ACAGCCTCCT 1561 TAACTGTGAA AGGATTCGCT TCAGATCGTT TTCTTTATGC GAACAGGACC CCTATGTACA 1621 TGACCGACTC CAATGACACC ATTTCCAATG GCACCAATGC CAATACTTTT TCCCTGGACC 1681 TTAAAACAAT ACTGGTGTCT ACAGCTATGG GCTGCTTCAC ATTCCTGGGA GTGGTTTTAT 1741 TTTGTTTTCT TCTCCTTTTT GTGTGGAGCC GAGGGAAAGG CAAGCACAAA AACAGCATTG 1801 ACCTTGAGTA TGTGCCCAGA AAAAACAATG GTGCTGTTGT GGAAGGGGAG GTAGCTGGAC 1861 CCAGGAGGTT CAACATGAAA ATGATTTTGC CAACTTTCTT GTACAAAGTG GTTGATATCG 1921 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1981 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAGGCTGGCT 2041 CGGTGGCCAA ATAACAACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 2101 aagatt