Transcript: Human XR_001746186.2

PREDICTED: Homo sapiens leucine rich repeat and Ig domain containing 2 (LINGO2), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LINGO2 (158038)
Length:
12580
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001746186.2
NBCI Gene record:
LINGO2 (158038)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001746186.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432854 ATCAAGACAGCGGGATGTATG pLKO_005 3977 3UTR 100% 10.800 15.120 N LINGO2 n/a
2 TRCN0000161227 GCAACTTAACAGCAGTACCAA pLKO.1 3113 3UTR 100% 3.000 2.400 N LINGO2 n/a
3 TRCN0000428879 GAGCATTCAACAATCTCTTTA pLKO_005 2849 3UTR 100% 13.200 9.240 N LINGO2 n/a
4 TRCN0000159434 GCATCTGAAGCATCTCAATAT pLKO.1 3171 3UTR 100% 13.200 9.240 N LINGO2 n/a
5 TRCN0000164140 CCCAGGAGGTTCAACATGAAA pLKO.1 4345 3UTR 100% 5.625 3.938 N LINGO2 n/a
6 TRCN0000160479 CATTACTGTCTCTTTGTCAAT pLKO.1 4389 3UTR 100% 4.950 3.465 N LINGO2 n/a
7 TRCN0000163895 CCTTTCAGTCACCAACACCAA pLKO.1 3312 3UTR 100% 2.640 1.848 N LINGO2 n/a
8 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 8929 3UTR 100% 4.950 2.475 Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001746186.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09716 pDONR223 100% 14.4% None 1_2553del;2865C>G;4372_12580del n/a
2 ccsbBroad304_09716 pLX_304 0% 14.4% V5 1_2553del;2865C>G;4372_12580del n/a
3 TRCN0000477721 GGCTGGCTCGGTGGCCAAATAACA pLX_317 19% 14.4% V5 1_2553del;2865C>G;4372_12580del n/a
Download CSV