Transcript: Mouse NM_001166001.1

Mus musculus leucine rich repeat and Ig domain containing 2 (Lingo2), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Lingo2 (242384)
Length:
3562
CDS:
231..2051

Additional Resources:

NCBI RefSeq record:
NM_001166001.1
NBCI Gene record:
Lingo2 (242384)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001166001.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159434 GCATCTGAAGCATCTCAATAT pLKO.1 848 CDS 100% 13.200 18.480 N LINGO2 n/a
2 TRCN0000188817 CGCCTTAAGTTGGTCCCTTTA pLKO.1 576 CDS 100% 10.800 15.120 N Lingo2 n/a
3 TRCN0000188053 CGGCACTAATGCCAATACTTT pLKO.1 1811 CDS 100% 5.625 7.875 N Lingo2 n/a
4 TRCN0000204606 CGTCTGATAGAGTGACTCGAT pLKO.1 2102 3UTR 100% 2.640 2.112 N Lingo2 n/a
5 TRCN0000186155 CATCCGTGAGAGATCATTTAA pLKO.1 1391 CDS 100% 15.000 10.500 N Lingo2 n/a
6 TRCN0000164140 CCCAGGAGGTTCAACATGAAA pLKO.1 2022 CDS 100% 5.625 3.938 N LINGO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166001.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09716 pDONR223 100% 91.6% 97.6% None (many diffs) n/a
2 ccsbBroad304_09716 pLX_304 0% 91.6% 97.6% V5 (many diffs) n/a
3 TRCN0000477721 GGCTGGCTCGGTGGCCAAATAACA pLX_317 19% 91.6% 97.6% V5 (many diffs) n/a
Download CSV