Construct: ORF TRCN0000477820
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015667.1_s317c1
- Derived from:
- ccsbBroadEn_02833
- DNA Barcode:
- CTACAGTTACTGCCCCAACATCGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CADM1 (23705)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477820
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23705 | CADM1 | cell adhesion molecule 1 | NM_014333.4 | 100% | 100% | |
| 2 | human | 23705 | CADM1 | cell adhesion molecule 1 | NM_001301044.2 | 97.5% | 97.5% | 1078_1110del |
| 3 | human | 23705 | CADM1 | cell adhesion molecule 1 | XM_005271494.3 | 95.4% | 94.5% | (many diffs) |
| 4 | human | 23705 | CADM1 | cell adhesion molecule 1 | NM_001301045.2 | 94.8% | 94.3% | (many diffs) |
| 5 | human | 23705 | CADM1 | cell adhesion molecule 1 | NM_001301043.2 | 93.8% | 93.8% | 1076_1162del |
| 6 | human | 23705 | CADM1 | cell adhesion molecule 1 | NM_001098517.2 | 93.6% | 93.6% | 993_994ins84 |
| 7 | human | 23705 | CADM1 | cell adhesion molecule 1 | XM_017017457.2 | 84.5% | 83.4% | (many diffs) |
| 8 | mouse | 54725 | Cadm1 | cell adhesion molecule 1 | NM_018770.3 | 92.2% | 97.9% | (many diffs) |
| 9 | mouse | 54725 | Cadm1 | cell adhesion molecule 1 | NM_207675.2 | 89.9% | 95.6% | (many diffs) |
| 10 | mouse | 54725 | Cadm1 | cell adhesion molecule 1 | NM_207676.2 | 87.7% | 92.5% | (many diffs) |
| 11 | mouse | 54725 | Cadm1 | cell adhesion molecule 1 | XM_006510497.3 | 87.3% | 92.3% | (many diffs) |
| 12 | mouse | 54725 | Cadm1 | cell adhesion molecule 1 | NM_001310841.1 | 86.5% | 91.9% | (many diffs) |
| 13 | mouse | 54725 | Cadm1 | cell adhesion molecule 1 | NM_001025600.1 | 85.9% | 91.6% | (many diffs) |
| 14 | mouse | 54725 | Cadm1 | cell adhesion molecule 1 | XM_017313489.1 | 60.9% | 64.2% | (many diffs) |
| 15 | mouse | 54725 | Cadm1 | cell adhesion molecule 1 | XM_017313487.1 | 58.5% | 61.7% | (many diffs) |
| 16 | mouse | 54725 | Cadm1 | cell adhesion molecule 1 | XM_017313488.1 | 58.5% | 61.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1395
- ORF length:
- 1326
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcgagtgta gtgctgccga gcggatccca gtgtgcggcg gcagcggcgg 121 cggcggcgcc tcccgggctc cggctccggc ttctgctgtt gctcttctcc gccgcggcac 181 tgatccccac aggtgatggg cagaatctgt ttacgaaaga cgtgacagtg atcgagggag 241 aggttgcgac catcagttgc caagtcaata agagtgacga ctctgtgatt cagctactga 301 atcccaacag gcagaccatt tatttcaggg acttcaggcc tttgaaggac agcaggtttc 361 agttgctgaa tttttctagc agtgaactca aagtatcatt gacaaacgtc tcaatttctg 421 atgaaggaag atacttttgc cagctctata ccgatccccc acaggaaagt tacaccacca 481 tcacagtcct ggtcccacca cgtaatctga tgatcgatat ccagaaagac actgcggtgg 541 aaggtgagga gattgaagtc aactgcactg ctatggccag caagccagcc acgactatca 601 ggtggttcaa agggaacaca gagctaaaag gcaaatcgga ggtggaagag tggtcagaca 661 tgtacactgt gaccagtcag ctgatgctga aggtgcacaa ggaggacgat ggggtcccag 721 tgatctgcca ggtggagcac cctgcggtca ctggaaacct gcagacccag cggtatctag 781 aagtacagta taagcctcaa gtgcacattc agatgactta tcctctacaa ggcttaaccc 841 gggaagggga cgcgcttgag ttaacatgtg aagccatcgg gaagccccag cctgtgatgg 901 taacttgggt gagagtcgat gatgaaatgc ctcaacacgc cgtactgtct gggcccaacc 961 tgttcatcaa taacctaaac aaaacagata atggtacata ccgctgtgaa gcttcaaaca 1021 tagtggggaa agctcactcg gattatatgc tgtatgtata cgatcccccc acaactatcc 1081 ctcctcccac aacaaccacc accaccacca ccaccaccac caccaccatc cttaccatca 1141 tcacagattc ccgagcaggt gaagaaggct cgatcagggc agtggatcat gccgtgatcg 1201 gtggcgtcgt ggcggtggtg gtgttcgcca tgctgtgctt gctcatcatt cTGGGGCGCT 1261 ATTTTGCCAG ACATAAAGGT ACATACTTCA CTCATGAAGC CAAAGGAGCC GATGACGCAG 1321 CAGACGCAGA CACAGCTATA ATCAATGCAG AAGGAGGACA GAACAACTCC GAAGAAAAGA 1381 AAGAGTACTT CATCTTGCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1441 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1501 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA CTACAGTTAC TGCCCCAACA 1561 TCGAACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt