Transcript: Human NM_001301044.2

Homo sapiens cell adhesion molecule 1 (CADM1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
CADM1 (23705)
Length:
8621
CDS:
22..1383

Additional Resources:

NCBI RefSeq record:
NM_001301044.2
NBCI Gene record:
CADM1 (23705)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001301044.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337126 AGACGCAGACACAGCTATAAT pLKO_005 1308 CDS 100% 15.000 21.000 N CADM1 n/a
2 TRCN0000124318 CGCAGACACAGCTATAATCAA pLKO.1 1311 CDS 100% 5.625 7.875 N Cadm1 n/a
3 TRCN0000317367 CGCAGACACAGCTATAATCAA pLKO_005 1311 CDS 100% 5.625 7.875 N Cadm1 n/a
4 TRCN0000337125 GAAAGCTCACTCGGATTATAT pLKO_005 981 CDS 100% 15.000 12.000 N CADM1 n/a
5 TRCN0000168617 GCCTGCATGTACTGTATATTA pLKO.1 2516 3UTR 100% 15.000 10.500 N CADM1 n/a
6 TRCN0000337195 GTGTCCAACTGGCCCTATTTA pLKO_005 1407 3UTR 100% 15.000 10.500 N CADM1 n/a
7 TRCN0000124315 CCTGTTCATCAATAACCTAAA pLKO.1 912 CDS 100% 10.800 7.560 N Cadm1 n/a
8 TRCN0000317433 CCTGTTCATCAATAACCTAAA pLKO_005 912 CDS 100% 10.800 7.560 N Cadm1 n/a
9 TRCN0000168069 CAGATGACTTATCCTCTACAA pLKO.1 763 CDS 100% 4.950 3.465 N CADM1 n/a
10 TRCN0000337124 CAGATGACTTATCCTCTACAA pLKO_005 763 CDS 100% 4.950 3.465 N CADM1 n/a
11 TRCN0000168206 CCAGACATAAAGGTACATACT pLKO.1 1253 CDS 100% 4.950 3.465 N CADM1 n/a
12 TRCN0000350784 CCAGACATAAAGGTACATACT pLKO_005 1253 CDS 100% 4.950 3.465 N CADM1 n/a
13 TRCN0000167235 CGGATTATATGCTGTATGTAT pLKO.1 992 CDS 100% 5.625 3.375 N CADM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001301044.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02833 pDONR223 100% 97.5% 97.5% None 1078_1110del n/a
2 ccsbBroad304_02833 pLX_304 0% 97.5% 97.5% V5 1078_1110del n/a
3 TRCN0000477820 CTACAGTTACTGCCCCAACATCGA pLX_317 11.4% 97.5% 97.5% V5 1078_1110del n/a
4 ccsbBroadEn_02832 pDONR223 100% 91.3% 91.3% None 992_1108del n/a
5 ccsbBroad304_02832 pLX_304 0% 91.3% 91.3% V5 992_1108del n/a
6 ccsbBroadEn_11757 pDONR223 100% 82.8% 83% None (many diffs) n/a
7 ccsbBroad304_11757 pLX_304 0% 82.8% 83% V5 (many diffs) n/a
8 TRCN0000481080 CCAATCATGGCTCGCCACAAAACT pLX_317 37.5% 82.8% 83% V5 (many diffs) n/a
Download CSV