Transcript: Mouse XM_017313489.1

PREDICTED: Mus musculus cell adhesion molecule 1 (Cadm1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cadm1 (54725)
Length:
13399
CDS:
589..1509

Additional Resources:

NCBI RefSeq record:
XM_017313489.1
NBCI Gene record:
Cadm1 (54725)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313489.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337126 AGACGCAGACACAGCTATAAT pLKO_005 1434 CDS 100% 15.000 21.000 N CADM1 n/a
2 TRCN0000124316 GCTATCTAGAAGTGCAGTATA pLKO.1 851 CDS 100% 13.200 18.480 N Cadm1 n/a
3 TRCN0000317432 GCTATCTAGAAGTGCAGTATA pLKO_005 851 CDS 100% 13.200 18.480 N Cadm1 n/a
4 TRCN0000313852 ACGTAACTTGATGATCGATAT pLKO_005 579 5UTR 100% 10.800 15.120 N Cadm1 n/a
5 TRCN0000349936 GGATTTGGTTTCGGTAGATTG pLKO_005 1826 3UTR 100% 10.800 15.120 N Cadm1 n/a
6 TRCN0000124318 CGCAGACACAGCTATAATCAA pLKO.1 1437 CDS 100% 5.625 4.500 N Cadm1 n/a
7 TRCN0000317367 CGCAGACACAGCTATAATCAA pLKO_005 1437 CDS 100% 5.625 4.500 N Cadm1 n/a
8 TRCN0000124314 CGGACTGGTTTGTAAAGGAAA pLKO.1 3540 3UTR 100% 4.950 3.960 N Cadm1 n/a
9 TRCN0000124317 CCACGTAACTTGATGATCGAT pLKO.1 577 5UTR 100% 3.000 2.400 N Cadm1 n/a
10 TRCN0000124315 CCTGTTCATCAATAACCTAAA pLKO.1 1038 CDS 100% 10.800 7.560 N Cadm1 n/a
11 TRCN0000317433 CCTGTTCATCAATAACCTAAA pLKO_005 1038 CDS 100% 10.800 7.560 N Cadm1 n/a
12 TRCN0000168206 CCAGACATAAAGGTACATACT pLKO.1 1379 CDS 100% 4.950 3.465 N CADM1 n/a
13 TRCN0000350784 CCAGACATAAAGGTACATACT pLKO_005 1379 CDS 100% 4.950 3.465 N CADM1 n/a
14 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7684 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313489.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02833 pDONR223 100% 60.9% 64.2% None (many diffs) n/a
2 ccsbBroad304_02833 pLX_304 0% 60.9% 64.2% V5 (many diffs) n/a
3 TRCN0000477820 CTACAGTTACTGCCCCAACATCGA pLX_317 11.4% 60.9% 64.2% V5 (many diffs) n/a
4 ccsbBroadEn_02832 pDONR223 100% 54.8% 58% None (many diffs) n/a
5 ccsbBroad304_02832 pLX_304 0% 54.8% 58% V5 (many diffs) n/a
6 ccsbBroadEn_11757 pDONR223 100% 46.7% 49.6% None (many diffs) n/a
7 ccsbBroad304_11757 pLX_304 0% 46.7% 49.6% V5 (many diffs) n/a
8 TRCN0000481080 CCAATCATGGCTCGCCACAAAACT pLX_317 37.5% 46.7% 49.6% V5 (many diffs) n/a
Download CSV