Transcript: Human NM_014333.4

Homo sapiens cell adhesion molecule 1 (CADM1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
CADM1 (23705)
Length:
8588
CDS:
22..1350

Additional Resources:

NCBI RefSeq record:
NM_014333.4
NBCI Gene record:
CADM1 (23705)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014333.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337126 AGACGCAGACACAGCTATAAT pLKO_005 1275 CDS 100% 15.000 21.000 N CADM1 n/a
2 TRCN0000124318 CGCAGACACAGCTATAATCAA pLKO.1 1278 CDS 100% 5.625 7.875 N Cadm1 n/a
3 TRCN0000317367 CGCAGACACAGCTATAATCAA pLKO_005 1278 CDS 100% 5.625 7.875 N Cadm1 n/a
4 TRCN0000337125 GAAAGCTCACTCGGATTATAT pLKO_005 981 CDS 100% 15.000 12.000 N CADM1 n/a
5 TRCN0000168617 GCCTGCATGTACTGTATATTA pLKO.1 2483 3UTR 100% 15.000 10.500 N CADM1 n/a
6 TRCN0000337195 GTGTCCAACTGGCCCTATTTA pLKO_005 1374 3UTR 100% 15.000 10.500 N CADM1 n/a
7 TRCN0000124315 CCTGTTCATCAATAACCTAAA pLKO.1 912 CDS 100% 10.800 7.560 N Cadm1 n/a
8 TRCN0000317433 CCTGTTCATCAATAACCTAAA pLKO_005 912 CDS 100% 10.800 7.560 N Cadm1 n/a
9 TRCN0000168069 CAGATGACTTATCCTCTACAA pLKO.1 763 CDS 100% 4.950 3.465 N CADM1 n/a
10 TRCN0000337124 CAGATGACTTATCCTCTACAA pLKO_005 763 CDS 100% 4.950 3.465 N CADM1 n/a
11 TRCN0000168206 CCAGACATAAAGGTACATACT pLKO.1 1220 CDS 100% 4.950 3.465 N CADM1 n/a
12 TRCN0000350784 CCAGACATAAAGGTACATACT pLKO_005 1220 CDS 100% 4.950 3.465 N CADM1 n/a
13 TRCN0000167235 CGGATTATATGCTGTATGTAT pLKO.1 992 CDS 100% 5.625 3.375 N CADM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014333.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02833 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02833 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477820 CTACAGTTACTGCCCCAACATCGA pLX_317 11.4% 100% 100% V5 n/a
4 ccsbBroadEn_02832 pDONR223 100% 93.6% 93.6% None 994_1077del n/a
5 ccsbBroad304_02832 pLX_304 0% 93.6% 93.6% V5 994_1077del n/a
6 ccsbBroadEn_11757 pDONR223 100% 84.8% 85% None (many diffs) n/a
7 ccsbBroad304_11757 pLX_304 0% 84.8% 85% V5 (many diffs) n/a
8 TRCN0000481080 CCAATCATGGCTCGCCACAAAACT pLX_317 37.5% 84.8% 85% V5 (many diffs) n/a
Download CSV