Transcript: Mouse XM_011241408.2

PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 4 (Cnot4), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cnot4 (53621)
Length:
3341
CDS:
203..2344

Additional Resources:

NCBI RefSeq record:
XM_011241408.2
NBCI Gene record:
Cnot4 (53621)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241408.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084991 CGGGTTCAGTTGATAAGAATA pLKO.1 969 CDS 100% 13.200 10.560 N Cnot4 n/a
2 TRCN0000321590 ACCATTACAAAGGTATGATAC pLKO_005 1003 CDS 100% 10.800 8.640 N Cnot4 n/a
3 TRCN0000084992 CCCATTGACAAACCTTCAGAT pLKO.1 1025 CDS 100% 4.950 3.960 N Cnot4 n/a
4 TRCN0000321587 GTATAGGGAATGGTGATAATT pLKO_005 1053 CDS 100% 15.000 10.500 N Cnot4 n/a
5 TRCN0000321588 CACTCTGCTGCACCTACAAAT pLKO_005 1565 CDS 100% 13.200 9.240 N Cnot4 n/a
6 TRCN0000084989 CCCTTGGAAATAGATGATATT pLKO.1 260 CDS 100% 13.200 9.240 N Cnot4 n/a
7 TRCN0000321591 GCACCTGTGGCTACCAGATAT pLKO_005 294 CDS 100% 13.200 9.240 N Cnot4 n/a
8 TRCN0000015215 GCCTCTTCACATCAGAAACAA pLKO.1 1317 CDS 100% 5.625 3.938 N CNOT4 n/a
9 TRCN0000015213 CCCTGTAGTTTCTGGACGTTT pLKO.1 3254 3UTR 100% 4.950 3.465 N CNOT4 n/a
10 TRCN0000084990 GCCAGTGCTTATGTAACGTAT pLKO.1 671 CDS 100% 4.950 3.465 N Cnot4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241408.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06649 pDONR223 100% 74.3% 75.4% None (many diffs) n/a
2 ccsbBroad304_06649 pLX_304 0% 74.3% 75.4% V5 (many diffs) n/a
3 TRCN0000477893 GTGAGGCCTCGTTTGACCTCTCAA pLX_317 21.6% 74.3% 75.4% V5 (many diffs) n/a
Download CSV