Transcript: Human NM_001366511.1

Homo sapiens repulsive guidance molecule BMP co-receptor b (RGMB), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
RGMB (285704)
Length:
4436
CDS:
262..1695

Additional Resources:

NCBI RefSeq record:
NM_001366511.1
NBCI Gene record:
RGMB (285704)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366511.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137095 CCCTCTTCTTAACCGTTTCTT pLKO.1 2601 3UTR 100% 5.625 7.875 N RGMB n/a
2 TRCN0000137746 GCCTCACCTTACGAATCCAAA pLKO.1 2679 3UTR 100% 4.950 6.930 N RGMB n/a
3 TRCN0000365323 TGGCCACTCATAGATAATAAT pLKO_005 940 CDS 100% 15.000 10.500 N RGMB n/a
4 TRCN0000365393 GCTACAAATAAGATCACTATT pLKO_005 1015 CDS 100% 13.200 9.240 N RGMB n/a
5 TRCN0000370502 ACTCACCTGCTTGATCCTTAT pLKO_005 1662 CDS 100% 10.800 7.560 N RGMB n/a
6 TRCN0000365395 CCCATGATCCTTGCAACTATC pLKO_005 785 CDS 100% 10.800 7.560 N RGMB n/a
7 TRCN0000133928 CCTCAGAACTTTCAAGGATAA pLKO.1 891 CDS 100% 10.800 7.560 N RGMB n/a
8 TRCN0000134185 CCCACAGATTACTTTCAGAAA pLKO.1 3994 3UTR 100% 4.950 3.465 N RGMB n/a
9 TRCN0000370437 CCACTGGTGATGCCAACTTTA pLKO_005 1514 CDS 100% 13.200 7.920 N RGMB n/a
10 TRCN0000370438 TGCCAGTGAAGGACATCTATT pLKO_005 1466 CDS 100% 13.200 7.920 N RGMB n/a
11 TRCN0000138377 CCAGAGGAATTGTTCCAAGGA pLKO.1 732 CDS 100% 2.640 1.584 N RGMB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366511.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09984 pDONR223 100% 99.5% 98.9% None (many diffs) n/a
2 ccsbBroad304_09984 pLX_304 0% 99.5% 98.9% V5 (many diffs) n/a
3 TRCN0000477953 TTTCAAATGTTACTTCTATTTTGT pLX_317 28.8% 99.5% 98.9% V5 (many diffs) n/a
Download CSV