Construct: ORF TRCN0000477983
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014720.1_s317c1
- Derived from:
- ccsbBroadEn_11326
- DNA Barcode:
- ATATCTCCAGTATACTTTCAGAAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HIP1R (9026)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477983
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9026 | HIP1R | huntingtin interacting prot... | NM_001303097.2 | 99.8% | 99.8% | 210C>T;1034A>G |
| 2 | human | 9026 | HIP1R | huntingtin interacting prot... | NM_001303099.2 | 94.6% | 94% | (many diffs) |
| 3 | human | 9026 | HIP1R | huntingtin interacting prot... | NM_003959.3 | 57.1% | 56.4% | (many diffs) |
| 4 | human | 9026 | HIP1R | huntingtin interacting prot... | XM_011538963.1 | 54.5% | 53.3% | (many diffs) |
| 5 | human | 9026 | HIP1R | huntingtin interacting prot... | XM_024449270.1 | 37.9% | 37.3% | (many diffs) |
| 6 | mouse | 29816 | Hip1r | huntingtin interacting prot... | XR_387569.3 | 67.5% | (many diffs) | |
| 7 | mouse | 29816 | Hip1r | huntingtin interacting prot... | XM_006530370.3 | 57.9% | 59.7% | (many diffs) |
| 8 | mouse | 29816 | Hip1r | huntingtin interacting prot... | XM_006530369.3 | 57.8% | 59.7% | (many diffs) |
| 9 | mouse | 29816 | Hip1r | huntingtin interacting prot... | XR_387568.3 | 57.3% | (many diffs) | |
| 10 | mouse | 29816 | Hip1r | huntingtin interacting prot... | NM_145070.3 | 50.2% | 51.8% | (many diffs) |
| 11 | mouse | 29816 | Hip1r | huntingtin interacting prot... | XR_387567.3 | 36.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1914
- ORF length:
- 1845
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaacagcatc aagaacgtgc cggcgcgggt gctgagccgc aggccgggcc 121 acagcctgga ggccgagcgc gagcagttcg acaagaccca ggccatcagc atcagcaaag 181 ccatcaacac ccaggaggcc cccgtgaagg agaagcacgc ccggcgcatc attctgggca 241 cacaccacga gaagggggct ttcaccttct ggtcctatgc cattgggctg ccgctgccca 301 gcagctccat tctcagctgg aagttctgcc acgtcctcca caaggtcctt cgagacgggc 361 accccaatgt gctgcatgac tgccagcggt accgcagcaa catccgggag attggagacc 421 tgtggggaca tttgcatgac cgctacggac agctggtgaa tgtctacacc aagctgctgc 481 tgaccaagat ctccttccac ctcaagcatc cccagtttcc cgcgggcctg gaggtgacag 541 atgaggtact ggagaaggca gctgggaccg atgtcaacaa catcttccag ctcactgtgg 601 agatgtttga ttacatggat tgtgagctga agctttctga atcagttttc cgacagctca 661 acacggccat cgccgtatcc cagatgtcct caggccagtg ccgcctggcc cccctcatcc 721 aggtcatcca ggactgcagc cacctctacc actacacggt caagctcctg ttcaagctac 781 actcttgtct ccctgcggac accctgcaag gccacaggga ccggttccac gagcagtttc 841 acagcctcag gaacttcttc cgcagagcct ccgacatgct gtacttcaag cggctcatcc 901 agatcccccg gctgcccgag ggacccccta acttcctgcg ggcctcagcc ctggctgagc 961 acatcaagcc ggtggtggtg atccccgagg aggccccgga agatgaggag ccggagaatc 1021 tcattgagat cagcacaggg ccccccgcgg gggagccagt ggtggtggct gacctcttcg 1081 atcagacgtt tggacccccc agtgggtctg tgaaggacga cagggacctc cagattgaga 1141 gcttgaagag agaggtggaa atgctccgct ctgaactgga gaagatcaag ctggaggccc 1201 agcggtacat cgcgcagctg aagagccagg tgaatgcact ggagggtgag ctggaggagc 1261 agcggaagca gaagcagaag gccctggtgg ataatgagca gctccgccac gagctggccc 1321 agctgagggc tgcccagctg gagggcgagc ggagccaggg cctgcgtgag gaggctgaga 1381 ggaaggccag tgccacggag gcgcgctaca acaagctgaa ggaaaagcac agtgagctcg 1441 tccatgtgca cgcggagctg ctcagaaaga acgcggacac agccaagcag ctgacggtga 1501 cgcagcaaag ccaggaggag gtggcgcggg tgaaggagca gctggccttc caggtggagc 1561 aggtgaagcg ggagtcggag ttgaagctag aggagaagag cgaccagctg gagaagctca 1621 agagggagct ggaggccaag gccggagagc tggcccgcgc gcaggaggcc cTGAGCCACA 1681 CAGAGCAGAG CAAGTCGGAG CTGAGCTCAC GGCTGGACAC GCTGAGTGCG GAGAAGGATG 1741 CTCTGAGTGG AGCTGTGCGG CAGCGGGAGG CAGACCTGCT GGCGGCGCAG AGCCTGGTGC 1801 GCGAGACAGA GGCGGCGCTG AGCCGGGAGC AGCAGCGCAG CTCCCAGGAG CAGGGCGAGT 1861 TGCAGGGCCG GCTGGCAGAG AGGGTATGGC CTCCCCAGAT GCAGCAGCAC CACTTGCCAA 1921 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1981 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 2041 TATCTTGTGG AAAGGACGAA TATCTCCAGT ATACTTTCAG AAGACGCGTT AAGTCgacaa 2101 tcaacctctg gattacaaaa tttgtgaaag att