Construct: ORF TRCN0000478117
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009442.1_s317c1
- Derived from:
- ccsbBroadEn_05397
- DNA Barcode:
- ACGCATTTCTACACACGGAAAATG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TPRG1 (285386)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478117
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 285386 | TPRG1 | tumor protein p63 regulated 1 | NM_198485.4 | 100% | 100% | |
| 2 | human | 285386 | TPRG1 | tumor protein p63 regulated 1 | XM_017006261.2 | 100% | 100% | |
| 3 | human | 285386 | TPRG1 | tumor protein p63 regulated 1 | XM_024453483.1 | 100% | 100% | |
| 4 | human | 285386 | TPRG1 | tumor protein p63 regulated 1 | XM_005247382.5 | 97.1% | 97.1% | 1_24del |
| 5 | human | 285386 | TPRG1 | tumor protein p63 regulated 1 | XM_011512732.2 | 93.2% | 93.2% | 300_359del |
| 6 | human | 285386 | TPRG1 | tumor protein p63 regulated 1 | XM_017006257.1 | 93.2% | 93.2% | 300_359del |
| 7 | human | 285386 | TPRG1 | tumor protein p63 regulated 1 | XM_017006258.1 | 93.2% | 93.2% | 300_359del |
| 8 | human | 285386 | TPRG1 | tumor protein p63 regulated 1 | XM_017006259.1 | 93.2% | 93.2% | 300_359del |
| 9 | human | 285386 | TPRG1 | tumor protein p63 regulated 1 | XM_017006260.1 | 93.2% | 93.2% | 300_359del |
| 10 | human | 285386 | TPRG1 | tumor protein p63 regulated 1 | XM_024453473.1 | 93.2% | 93.2% | 300_359del |
| 11 | human | 285386 | TPRG1 | tumor protein p63 regulated 1 | XM_024453474.1 | 93.2% | 93.2% | 300_359del |
| 12 | human | 285386 | TPRG1 | tumor protein p63 regulated 1 | XM_024453475.1 | 93.2% | 93.2% | 300_359del |
| 13 | human | 285386 | TPRG1 | tumor protein p63 regulated 1 | XM_024453476.1 | 93.2% | 93.2% | 300_359del |
| 14 | human | 285386 | TPRG1 | tumor protein p63 regulated 1 | XM_024453477.1 | 93.2% | 93.2% | 300_359del |
| 15 | human | 285386 | TPRG1 | tumor protein p63 regulated 1 | XM_024453478.1 | 93.2% | 93.2% | 300_359del |
| 16 | human | 285386 | TPRG1 | tumor protein p63 regulated 1 | XM_024453479.1 | 93.2% | 93.2% | 300_359del |
| 17 | human | 285386 | TPRG1 | tumor protein p63 regulated 1 | XM_024453480.1 | 93.2% | 93.2% | 300_359del |
| 18 | human | 285386 | TPRG1 | tumor protein p63 regulated 1 | XM_024453481.1 | 93.2% | 93.2% | 300_359del |
| 19 | human | 285386 | TPRG1 | tumor protein p63 regulated 1 | XM_024453482.1 | 93.2% | 93.2% | 300_359del |
| 20 | human | 285386 | TPRG1 | tumor protein p63 regulated 1 | XM_011512734.3 | 78% | 75.2% | (many diffs) |
| 21 | human | 285386 | TPRG1 | tumor protein p63 regulated 1 | XM_011512735.3 | 76.3% | 76.3% | 1_24del;324_325ins177 |
| 22 | human | 285386 | TPRG1 | tumor protein p63 regulated 1 | XM_017006262.1 | 67.1% | 65% | (many diffs) |
| 23 | human | 285386 | TPRG1 | tumor protein p63 regulated 1 | XM_017006263.1 | 67.1% | 65% | (many diffs) |
| 24 | human | 285386 | TPRG1 | tumor protein p63 regulated 1 | XM_011512736.3 | 45.1% | 35.1% | (many diffs) |
| 25 | human | 285386 | TPRG1 | tumor protein p63 regulated 1 | XM_005247388.4 | 42.6% | 38% | (many diffs) |
| 26 | mouse | 71338 | Tprg | transformation related prot... | NM_175165.3 | 84% | 81.3% | (many diffs) |
| 27 | mouse | 71338 | Tprg | transformation related prot... | XM_006522581.2 | 84% | 81.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 894
- ORF length:
- 825
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtcaacaatt gggagttttg aaggattcca ggctgtgtct ctgaagcaag 121 agggagatga ccaaccctct gagactgacc acctatcgat ggaggaagag gacccgatgc 181 caagacagat ttcaaggcag tcaagtgtga ccgaatcaac tctttacccc aatccttatc 241 atcagcctta tatctcacgg aagtactttg ctacacggcc gggggccatt gagactgcca 301 tggaagactt gaaaggtcac gtagctgaga cttctggaga gaccattcaa ggcttctggc 361 tcttgacaaa gatagaccac tggaacaatg agaaggagag aattctactg gtcacagaca 421 agactctctt gatctgcaaa tacgacttca tcatgctgag ttgtgtgcag ctgcagcgga 481 ttcctctgag cgctgtctat cgcatctgcc tgggcaagtt caccttccct gggatgtccc 541 tggacaagag acaaggagaa ggccttagga tcTACTGGGG GAGTCCGGAG GAGCAGTCTC 601 TTCTGTCCCG CTGGAACCCA TGGTCCACTG AAGTTCCTTA TGCTACTTTC ACTGAGCATC 661 CTATGAAATA CACCAGTGAG AAATTCCTTG AAATTTGCAA GTTGTCTGGG TTCATGTCTA 721 AGCTTGTTCC AGCTATCCAG AATGCCCACA AGAATTCAAC TGGATCTGGA AGAGGAAAGA 781 AACTGATGGT GTTAACTGAA CCCATTTTGA TTGAGACCTA CACAGGGCTG ATGTCATTCA 841 TTGGAAACCG CAACAAACTT GGCTATTCCC TTGCCCGTGG GAGTATTGGT TTTTTGCCAA 901 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 961 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1021 TATCTTGTGG AAAGGACGAA CGCATTTCTA CACACGGAAA ATGACGCGTT AAGTCgacaa 1081 tcaacctctg gattacaaaa tttgtgaaag att