Transcript: Human XM_024453474.1

PREDICTED: Homo sapiens tumor protein p63 regulated 1 (TPRG1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TPRG1 (285386)
Length:
6571
CDS:
1200..2087

Additional Resources:

NCBI RefSeq record:
XM_024453474.1
NBCI Gene record:
TPRG1 (285386)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453474.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419702 GTCTCACTGTCTCTAGTATTT pLKO_005 2481 3UTR 100% 13.200 10.560 N TPRG1 n/a
2 TRCN0000128856 GTCATTCATTGGAAACCGCAA pLKO.1 2024 CDS 100% 2.160 1.728 N TPRG1 n/a
3 TRCN0000428836 AGCCCTCTTATCCTGATTTAT pLKO_005 2448 3UTR 100% 15.000 10.500 N TPRG1 n/a
4 TRCN0000130198 CCAGTCTGTAACAATGGGATA pLKO.1 4117 3UTR 100% 4.050 2.835 N TPRG1 n/a
5 TRCN0000128948 CAAGACTCTCTTGATCTGCAA pLKO.1 1610 CDS 100% 2.640 1.848 N TPRG1 n/a
6 TRCN0000129468 GCCAAGACAGATTTCAAGGCA pLKO.1 1310 CDS 100% 0.750 0.525 N TPRG1 n/a
7 TRCN0000129049 GCCTGTTAAATGGAATCCCTA pLKO.1 2891 3UTR 100% 2.640 1.584 N TPRG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453474.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05397 pDONR223 100% 93.2% 93.2% None 300_359del n/a
2 ccsbBroad304_05397 pLX_304 0% 93.2% 93.2% V5 300_359del n/a
3 TRCN0000478117 ACGCATTTCTACACACGGAAAATG pLX_317 39.1% 93.2% 93.2% V5 300_359del n/a
Download CSV