Transcript: Mouse XM_006522581.2

PREDICTED: Mus musculus transformation related protein 63 regulated (Tprg), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tprg (71338)
Length:
2375
CDS:
263..1102

Additional Resources:

NCBI RefSeq record:
XM_006522581.2
NBCI Gene record:
Tprg (71338)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522581.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128856 GTCATTCATTGGAAACCGCAA pLKO.1 1039 CDS 100% 2.160 3.024 N TPRG1 n/a
2 TRCN0000249417 AGACAGCAGAGTATAACTAAA pLKO_005 401 CDS 100% 13.200 9.240 N Tprg n/a
3 TRCN0000257863 AGACCCTCTTGATCTGCAAAT pLKO_005 627 CDS 100% 10.800 7.560 N Tprg n/a
4 TRCN0000249416 AGATTGATCACTGGAACAATG pLKO_005 576 CDS 100% 10.800 7.560 N Tprg n/a
5 TRCN0000249419 TTATCGCCAGCCCTATGTTTC pLKO_005 442 CDS 100% 10.800 7.560 N Tprg n/a
6 TRCN0000249418 TTGTTCCAGCCATCGAGAATG pLKO_005 930 CDS 100% 10.800 7.560 N Tprg n/a
7 TRCN0000038816 CCTCGTCTAATGAAATCCTTA pLKO.1 2023 3UTR 100% 4.950 3.465 N USP44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522581.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05397 pDONR223 100% 84% 81.3% None (many diffs) n/a
2 ccsbBroad304_05397 pLX_304 0% 84% 81.3% V5 (many diffs) n/a
3 TRCN0000478117 ACGCATTTCTACACACGGAAAATG pLX_317 39.1% 84% 81.3% V5 (many diffs) n/a
Download CSV