Transcript: Human XM_011510632.2

PREDICTED: Homo sapiens transmembrane protein 182 (TMEM182), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM182 (130827)
Length:
1142
CDS:
186..710

Additional Resources:

NCBI RefSeq record:
XM_011510632.2
NBCI Gene record:
TMEM182 (130827)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510632.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000369119 CTATGACTCTGCAGTTATTTA pLKO_005 500 CDS 100% 15.000 21.000 N TMEM182 n/a
2 TRCN0000377272 CTTCTGGAGGTGTTGGTTTAA pLKO_005 350 CDS 100% 13.200 9.240 N TMEM182 n/a
3 TRCN0000005751 GTGGAAGAGAATGACTCCAAT pLKO.1 378 CDS 100% 4.950 3.465 N TMEM182 n/a
4 TRCN0000005750 GCTGTAGTCATCGCAAGCTTT pLKO.1 561 CDS 100% 4.950 2.970 N TMEM182 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510632.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09530 pDONR223 100% 73.9% 68.2% None (many diffs) n/a
2 ccsbBroad304_09530 pLX_304 0% 73.9% 68.2% V5 (many diffs) n/a
3 TRCN0000478198 CGCCTCCACCATATAGCTGTATCT pLX_317 39.5% 73.9% 68.2% V5 (many diffs) n/a
4 ccsbBroadEn_13156 pDONR223 100% 22.3% 17.1% None (many diffs) n/a
5 ccsbBroad304_13156 pLX_304 0% 22.3% 17.1% V5 (many diffs) n/a
6 TRCN0000475516 GTACATAGGTGTTTTATTCAGTGA pLX_317 80.2% 22.3% 17.1% V5 (many diffs) n/a
Download CSV