Construct: ORF TRCN0000478295
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015075.1_s317c1
- Derived from:
- ccsbBroadEn_10696
- DNA Barcode:
- GATATACCGAACGCATACGGCCGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CEACAM1 (634)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478295
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 634 | CEACAM1 | CEA cell adhesion molecule 1 | NM_001205344.2 | 100% | 100% | |
| 2 | human | 634 | CEACAM1 | CEA cell adhesion molecule 1 | NM_001024912.3 | 98.4% | 98% | 1374_1378delCAGCT;1392_1393insTGACCCACCTAACAAGA |
| 3 | human | 634 | CEACAM1 | CEA cell adhesion molecule 1 | NM_001712.5 | 88.9% | 87.6% | 1374_1431del;1463_1578del |
| 4 | human | 634 | CEACAM1 | CEA cell adhesion molecule 1 | NM_001184816.2 | 77.9% | 77.3% | 958_959ins288;1086_1090delCAGCT;1104_1105insTGACCCACCTAACAAGA |
| 5 | human | 634 | CEACAM1 | CEA cell adhesion molecule 1 | NM_001184815.2 | 75.1% | 70.9% | (many diffs) |
| 6 | human | 634 | CEACAM1 | CEA cell adhesion molecule 1 | XM_011527206.2 | 75% | 69.4% | 957_958ins134;1053_1054ins217 |
| 7 | human | 634 | CEACAM1 | CEA cell adhesion molecule 1 | NM_001184813.2 | 70.7% | 69.2% | 958_959ins288;1086_1143del;1175_1290del |
| 8 | human | 1048 | CEACAM5 | CEA cell adhesion molecule 5 | XM_011526322.2 | 66.1% | 58.4% | (many diffs) |
| 9 | human | 4680 | CEACAM6 | CEA cell adhesion molecule 6 | NM_002483.7 | 66% | 61.3% | (many diffs) |
| 10 | human | 1088 | CEACAM8 | CEA cell adhesion molecule 8 | XM_017026194.1 | 65.3% | 53.3% | (many diffs) |
| 11 | human | 1088 | CEACAM8 | CEA cell adhesion molecule 8 | NM_001816.4 | 65% | 57.6% | (many diffs) |
| 12 | human | 1088 | CEACAM8 | CEA cell adhesion molecule 8 | XM_017026195.1 | 65% | 57.6% | (many diffs) |
| 13 | human | 4680 | CEACAM6 | CEA cell adhesion molecule 6 | XM_011526990.2 | 62.1% | 58.3% | (many diffs) |
| 14 | human | 1088 | CEACAM8 | CEA cell adhesion molecule 8 | XM_017026196.1 | 61.9% | 54.3% | (many diffs) |
| 15 | human | 1048 | CEACAM5 | CEA cell adhesion molecule 5 | XM_017026146.2 | 56.9% | 50.1% | (many diffs) |
| 16 | human | 1088 | CEACAM8 | CEA cell adhesion molecule 8 | XM_011526341.1 | 48.6% | 41.7% | (many diffs) |
| 17 | human | 1088 | CEACAM8 | CEA cell adhesion molecule 8 | XM_011526342.1 | 48.6% | 41.7% | (many diffs) |
| 18 | human | 1088 | CEACAM8 | CEA cell adhesion molecule 8 | XM_017026198.1 | 48.6% | 41.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1470
- ORF length:
- 1404
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg gcacctctca gccccacttc acagagtgcg tgtaccctgg caggggcttc 121 tgctcacagc ctcacttcta accttctgga acccgcccac cactgcccag ctcactactg 181 aatccatgcc attcaatgtt gcagagggga aggaggttct tctccttgtc cacaatctgc 241 cccagcaact ttttggctac agctggtaca aaggggaaag agtggatggc aaccgtcaaa 301 ttgtaggata tgcaatagga actcaacaag ctaccccagg gcccgcaaac agcggtcgag 361 agacaatata ccccaatgca tccctgctga tccagaacgt cacccagaat gacacaggat 421 tctacaccct acaagtcata aagtcagatc ttgtgaatga agaagcaact ggacagttcc 481 atgtataccc ggagctgccc aagccctcca tctccagcaa caactccaac cctgtggagg 541 acaaggatgc tgtggccttc acctgtgaac ctgagactca ggacacaacc tacctgtggt 601 ggataaacaa tcagagcctc ccggtcagtc ccaggctgca gctgtccaat ggcaacagga 661 ccctcactct actcagtgtc acaaggaatg acacaggacc ctatgagtgt gaaatacaga 721 acccagtgag tgcgaaccgc agtgacccag tcaccttgaa tgtcacctat ggcccggaca 781 cccccaccat ttccccttca gacacctatt accgtccagg ggcaaacctc agcctctcct 841 gctatgcagc ctctaaccca cctgcacagt actcctggct tatcaatgga acattccagc 901 aaagcacaca agagctcttt atccctaaca tcactgtgaa taatagtgga tcctatacct 961 gccacgccaa taactcagtc actggctgca acaggaccac agtcaagacg atcatagtca 1021 ctgagctaag tccagtagta gcaaagcccc aaatcaaagc cagcaagacc acagtcacag 1081 gagataagga ctctgtgaac ctgacctgct ccacaaatga cactggaatc tccatccgtt 1141 ggttcttcaa aaaccagagt ctcccgtccT CGGAGAGGAT GAAGCTGTCC CAGGGCAACA 1201 CCACCCTCAG CATAAACCCT GTCAAGAGGG AGGATGCTGG GACGTATTGG TGTGAGGTCT 1261 TCAACCCAAT CAGTAAGAAC CAAAGCGACC CCATCATGCT GAACGTAAAC TATAATGCTC 1321 TACCACAAGA AAATGGCCTC TCACCTGGGG CCATTGCTGG CATTGTGATT GGAGTAGTGG 1381 CCCTGGTTGC TCTGATAGCA GTAGCCCTGG CATGTTTTCT GCATTTCGGG AAGACCGGCA 1441 GGACCACTCC AATGACCCAC CTAACAAGAT GCCCAACTTT CTTGTACAAA GTGGTTGATA 1501 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1561 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAGATAT 1621 ACCGAACGCA TACGGCCGGA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1681 tgaaagatt