Construct: ORF TRCN0000478333
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018197.1_s317c1
- Derived from:
- ccsbBroadEn_07360
- DNA Barcode:
- CGAATGTTCTCAGGAGAACTCCGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- USP10 (9100)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478333
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9100 | USP10 | ubiquitin specific peptidas... | NM_005153.3 | 99.8% | 99.7% | 603C>T;607T>C;610G>C |
| 2 | human | 9100 | USP10 | ubiquitin specific peptidas... | NM_001272075.2 | 99% | 98.8% | (many diffs) |
| 3 | human | 9100 | USP10 | ubiquitin specific peptidas... | XM_006721332.1 | 75.3% | 75.1% | (many diffs) |
| 4 | human | 9100 | USP10 | ubiquitin specific peptidas... | XM_011523443.1 | 75.3% | 75.1% | (many diffs) |
| 5 | human | 9100 | USP10 | ubiquitin specific peptidas... | XM_017023863.1 | 75.3% | 75.1% | (many diffs) |
| 6 | human | 9100 | USP10 | ubiquitin specific peptidas... | XM_017023864.1 | 75.3% | 75.1% | (many diffs) |
| 7 | human | 9100 | USP10 | ubiquitin specific peptidas... | XM_017023865.1 | 75.3% | 75.1% | (many diffs) |
| 8 | human | 9100 | USP10 | ubiquitin specific peptidas... | XM_017023866.2 | 75.3% | 75.1% | (many diffs) |
| 9 | human | 9100 | USP10 | ubiquitin specific peptidas... | XM_017023867.1 | 75.3% | 75.1% | (many diffs) |
| 10 | human | 9100 | USP10 | ubiquitin specific peptidas... | XM_017023868.1 | 75.3% | 75.1% | (many diffs) |
| 11 | human | 9100 | USP10 | ubiquitin specific peptidas... | XM_017023869.1 | 75.3% | 75.1% | (many diffs) |
| 12 | human | 9100 | USP10 | ubiquitin specific peptidas... | NR_073578.2 | 63.9% | (many diffs) | |
| 13 | human | 9100 | USP10 | ubiquitin specific peptidas... | NR_073577.2 | 40% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2460
- ORF length:
- 2394
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cctccacagc ccgcagtata tttttggaga ttttagccct gatgaattca 121 atcaattctt tgtgactcct cgatcttcag ttgagcttcc tccatacagt ggaacagttc 181 tgtgtggcac acaggctgtg gataaactac ctgatggaca agaatatcag agaattgagt 241 ttggtgtcga tgaagtcatt gaacccagtg acactttgcc gagaaccccc agctacagta 301 tttcaagcac actgaaccct caggcccctg aatttattct cggttgtaca gcttccaaaa 361 taacccctga tggtatcact aaagaagcaa gctatggctc catcgactgc cagtacccag 421 gctctgccct cgctttggat ggaagttcta atgtggaggc ggaagttttg gaaaatgatg 481 gtgtctcagg tggtcttgga caaagggagc gtaaaaagaa gaaaaagcgg ccacctggat 541 attacagcta tttgaaagat ggtggcgatg atagtatctc cacagaagcc ctggtcaatg 601 gccatgccaa ttcagcagtc ccgaacagtg tcagtgcaga ggatgcagaa tttatgggtg 661 acatgcctcc gccacttacg cccaggactt gtaacagccc ccagaactcc acagactctg 721 tcagtgacat tgtgcctgac agtcctttcc ccggagcact cggcagtgac accaggactg 781 cagggcagcc agaggggggc cccggggctg attttggtca gtcctgcttc cctgcagagg 841 ctggcagaga caccctgtca aggacagctg gggctcagcc ctgcgttggt accgatacta 901 ctgaaaacct tggagttgct aatggacaaa tacttgaatc ctcgggtgag ggcacagcta 961 ccaacggggt ggagttgcac accacggaaa gcatagactt ggacccaacc aaacccgaga 1021 gtgcatcacc tcctgctgac ggcacgggct ctgcatcagg cacccttcct gtcagccagc 1081 ccaagtcctg ggccagcctc tttcatgatt ctaagccctc ttcctcctcg ccggtggcct 1141 atgtggaaac taagtattcc cctcccgcca tatctcccct ggtttctgaa aagcaggttg 1201 aagtcaaaga agggcttgtt ccggtttcag aggatcctgt agccataaag attgcagagt 1261 tgctggagaa tgtaacccta atccataaac cagtgtcgtt gcaaccccgt gggctgatca 1321 ataaagggaa ctggtgctac attaatgcta cactgcaggc attggttgct tgcccgccga 1381 tgtaccacct gatgaagttc attcctctgt attccaaagt gcaaaggcct tgtacgtcaa 1441 cacccatgat agacagcttt gttcggctaa tgaatgagtt cactaatatg ccagtacctc 1501 caaaaccccg acaagctctt ggagataaaa tcgtgaggga tattcgccct ggagctgcct 1561 ttgagcccac atatatttac agactcctga cagttaacaa gtcaagcctg tctgaaaagg 1621 gtcgacaaga agatgctgag gaatacttag gcttcattct aaatggactt catgaggaaa 1681 tgttgaacct aaagaagctt ctctcaccaa gtaatgaaaa acttacgatt tccaacggcc 1741 ccaaaaacca ctcggtcaat gaagaagagc aggaagaaca aggtgaagga agcgaggatg 1801 aatgggaaca agtgggcccc cggaacaaga cttccgtcac ccgccaggcg gattttgttc 1861 agactccaat caccggcatt tttggtggac acatcaggtc tgtggtttac cagcagagtt 1921 caaaagaatc tgccactttg cagccatttt tcacgttgca gttggatatc cagtcagaca 1981 agatacgcac agtccaggat gcactggaga gcttggtggc aagagaatct gtccaaggtt 2041 ataccacaaa aaccaaacaa gaggttgaga taagtcgaag agtgactctg gaaaaactcc 2101 ctcctgtcct cgtgctgcac cTGAAACGAT TCGTTTATGA GAAGACTGGT GGGTGCCAGA 2161 AGCTTATCAA AAATATTGAA TATCCTGTGG ACTTGGAAAT TAGTAAAGAA CTGCTTTCTC 2221 CAGGGGTTAA AAATAAGAAT TTTAAATGCC ACCGAACCTA TCGGCTCTTT GCAGTGGTCT 2281 ACCATCACGG CAACAGTGCG ACGGGCGGCC ATTACACTAC AGACGTCTTC CAGATCGGTC 2341 TGAATGGCTG GCTGCGCATC GATGACCAGA CAGTCAAGGT GATCAACCAG TACCAGGTGG 2401 TGAAACCAAC TGCTGAACGC ACAGCCTACC TCCTGTATTA CCGCCGAGTG GACCTGCTGT 2461 ACCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 2521 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 2581 TTTATATATC TTGTGGAAAG GACGACGAAT GTTCTCAGGA GAACTCCGAA CGCGTTAAGT 2641 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt