Transcript: Human XM_017023863.1

PREDICTED: Homo sapiens ubiquitin specific peptidase 10 (USP10), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USP10 (9100)
Length:
3525
CDS:
877..2685

Additional Resources:

NCBI RefSeq record:
XM_017023863.1
NBCI Gene record:
USP10 (9100)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023863.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273122 CACCTGAAACGATTCGTTTAT pLKO_005 2341 CDS 100% 13.200 18.480 N USP10 n/a
2 TRCN0000007434 CGACAAGCTCTTGGAGATAAA pLKO.1 1732 CDS 100% 13.200 18.480 N USP10 n/a
3 TRCN0000273190 CGACAAGCTCTTGGAGATAAA pLKO_005 1732 CDS 100% 13.200 18.480 N USP10 n/a
4 TRCN0000273191 ACCAGCAACAACACTTGTAAA pLKO_005 3014 3UTR 100% 13.200 9.240 N USP10 n/a
5 TRCN0000007431 CCTATGTGGAAACTAAGTATT pLKO.1 1361 CDS 100% 13.200 9.240 N USP10 n/a
6 TRCN0000273121 CCTATGTGGAAACTAAGTATT pLKO_005 1361 CDS 100% 13.200 9.240 N USP10 n/a
7 TRCN0000273192 GAGGATCCTGTAGCCATAAAG pLKO_005 1453 CDS 100% 13.200 9.240 N USP10 n/a
8 TRCN0000007432 CCCATGATAGACAGCTTTGTT pLKO.1 1666 CDS 100% 5.625 3.938 N USP10 n/a
9 TRCN0000007430 GCCTCTCTTTAGTGGCTCTTT pLKO.1 2752 3UTR 100% 4.950 3.465 N USP10 n/a
10 TRCN0000007433 GCTGTGGATAAACTACCTGAT pLKO.1 418 5UTR 100% 4.050 2.835 N USP10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023863.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07360 pDONR223 100% 75.3% 75.1% None (many diffs) n/a
2 ccsbBroad304_07360 pLX_304 0% 75.3% 75.1% V5 (many diffs) n/a
3 TRCN0000478333 CGAATGTTCTCAGGAGAACTCCGA pLX_317 14.4% 75.3% 75.1% V5 (many diffs) n/a
Download CSV