Construct: ORF TRCN0000478651
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004412.1_s317c1
- Derived from:
- ccsbBroadEn_01832
- DNA Barcode:
- AGCACCTCAACCCACTCTTGGTCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PAX8 (7849)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478651
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 7849 | PAX8 | paired box 8 | NM_003466.4 | 100% | 100% | |
2 | human | 7849 | PAX8 | paired box 8 | NM_013952.4 | 88.4% | 72.8% | 896_897ins79;1194_1195ins77 |
3 | human | 7849 | PAX8 | paired box 8 | NM_013953.4 | 71.3% | 58% | 774_775ins310;963_964ins77 |
4 | human | 7849 | PAX8 | paired box 8 | NM_013992.4 | 63.7% | 59.7% | 773_774ins412;861_862ins77 |
5 | mouse | 18510 | Pax8 | paired box 8 | NM_011040.4 | 90% | 96.7% | (many diffs) |
6 | mouse | 18510 | Pax8 | paired box 8 | XM_006497778.3 | 89.8% | 96.5% | (many diffs) |
7 | mouse | 18510 | Pax8 | paired box 8 | XM_006497779.3 | 89.8% | 96.5% | (many diffs) |
8 | mouse | 18510 | Pax8 | paired box 8 | XM_006497781.1 | 77.7% | 84.2% | (many diffs) |
9 | mouse | 18510 | Pax8 | paired box 8 | XM_006497780.2 | 77.5% | 84% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1416
- ORF length:
- 1350
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc tcacaactcc atcagatctg gccatggagg gctgaaccag ctgggagggg 121 cctttgtgaa tggcagacct ctgccggaag tggtccgcca gcgcatcgta gacctggccc 181 accagggtgt aaggccctgc gacatctctc gccagctccg cgtcagccat ggctgcgtca 241 gcaagatcct tggcaggtac tacgagactg gcagcatccg gcctggagtg atagggggct 301 ccaagcccaa ggtggccacc cccaaggtgg tggagaagat tggggactac aaacgccaga 361 accctaccat gtttgcctgg gagatccgag accggctcct ggctgagggc gtctgtgaca 421 atgacactgt gcccagtgtc agctccatta atagaatcat ccggaccaaa gtgcagcaac 481 cattcaacct ccctatggac agctgcgtgg ccaccaagtc cctgagtccc ggacacacgc 541 tgatccccag ctcagctgta actcccccgg agtcacccca gtcggattcc ctgggctcca 601 cctactccat caatgggctc ctgggcatcg ctcagcctgg cagcgacaag aggaaaatgg 661 atgacagtga tcaggatagc tgccgactaa gcattgactc acagagcagc agcagcggac 721 cccgaaagca ccttcgcacg gatgccttca gccagcacca cctcgagccg ctcgagtgcc 781 catttgagcg gcagcactac ccagaggcct atgcctcccc cagccacacc aaaggcgagc 841 agggcctcta cccgctgccc ttgctcaaca gcaccctgga cgacgggaag gccaccctga 901 ccccttccaa cacgccactg gggcgcaacc tctcgactca ccagacctac cccgtggtgg 961 cagatcctca ctcacccttc gccataaagc aggaaacccc cgaggtgtcc agttctagct 1021 ccaccccttc ctctttatct agctccgcct ttttggatct gcagcaagtc ggctccgggg 1081 tcccgccctt caatgccttt ccccatgctg cctccgtgta cgggcagttc acgggccagg 1141 ccctcctctc agggcGAGAG ATGGTGGGGC CCACGCTGCC CGGATACCCA CCCCACATCC 1201 CCACCAGCGG ACAGGGCAGC TATGCCTCCT CTGCCATCGC AGGCATGGTG GCAGGAAGTG 1261 AATACTCTGG CAATGCCTAT GGCCACACCC CCTACTCCTC CTACAGCGAG GCCTGGCGCT 1321 TCCCCAACTC CAGCTTGCTG AGTTCCCCAT ATTATTACAG TTCCACATCA AGGCCGAGTG 1381 CACCGCCCAC CACTGCCACG GCCTTTGACC ATCTGTACCC AACTTTCTTG TACAAAGTGG 1441 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1501 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1561 AAGCACCTCA ACCCACTCTT GGTCGACGCG TTAAGTCgac aatcaacctc tggattacaa 1621 aatttgtgaa agatt