Transcript: Mouse XM_006497780.2

PREDICTED: Mus musculus paired box 8 (Pax8), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pax8 (18510)
Length:
2360
CDS:
198..1367

Additional Resources:

NCBI RefSeq record:
XM_006497780.2
NBCI Gene record:
Pax8 (18510)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497780.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085778 CCTCACTGTAAATACCGTAAA pLKO.1 2169 3UTR 100% 10.800 15.120 N Pax8 n/a
2 TRCN0000426174 AGTCACACAAAGGAATCTTTA pLKO_005 1436 3UTR 100% 13.200 9.240 N Pax8 n/a
3 TRCN0000085781 CCACCCTGACATCTTCCAATA pLKO.1 1030 CDS 100% 10.800 7.560 N Pax8 n/a
4 TRCN0000085782 TGGCAATGACAACAAGAGAAA pLKO.1 773 CDS 100% 4.950 3.465 N Pax8 n/a
5 TRCN0000085779 CCTGCTGAGTTCTCCATATTA pLKO.1 1283 CDS 100% 15.000 9.000 N Pax8 n/a
6 TRCN0000085780 GCCTGCTGAGTTCTCCATATT pLKO.1 1282 CDS 100% 13.200 7.920 N Pax8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497780.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01832 pDONR223 100% 77.5% 84% None (many diffs) n/a
2 ccsbBroad304_01832 pLX_304 0% 77.5% 84% V5 (many diffs) n/a
3 TRCN0000478651 AGCACCTCAACCCACTCTTGGTCG pLX_317 19.7% 77.5% 84% V5 (many diffs) n/a
4 TRCN0000489099 AAACTTCCGAGGCGCTCTATTTCC pLX_317 14.6% 77.5% 84% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489693 TTAGTAAGGTCGATCTATTGCCCA pLX_317 25.6% 77.5% 83.8% V5 (many diffs) n/a
Download CSV