Transcript: Human NM_013952.4

Homo sapiens paired box 8 (PAX8), transcript variant PAX8C, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PAX8 (7849)
Length:
3976
CDS:
167..1363

Additional Resources:

NCBI RefSeq record:
NM_013952.4
NBCI Gene record:
PAX8 (7849)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_013952.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359747 TCAGGATAGCTGCCGACTAAG pLKO_005 772 CDS 100% 10.800 15.120 N PAX8 n/a
2 TRCN0000021278 CCGACTAAGCATTGACTCACA pLKO.1 784 CDS 100% 2.640 3.696 N PAX8 n/a
3 TRCN0000378252 ACACTCCCTGTGTGGTTAATT pLKO_005 1566 3UTR 100% 15.000 10.500 N PAX8 n/a
4 TRCN0000021277 CCCAGTGTCAGCTCCATTAAT pLKO.1 533 CDS 100% 15.000 10.500 N PAX8 n/a
5 TRCN0000426174 AGTCACACAAAGGAATCTTTA pLKO_005 1505 3UTR 100% 13.200 9.240 N Pax8 n/a
6 TRCN0000359675 TTAACACAACTCTAGCAATTA pLKO_005 1838 3UTR 100% 13.200 9.240 N PAX8 n/a
7 TRCN0000021275 GCAACCATTCAACCTCCCTAT pLKO.1 577 CDS 100% 4.050 2.835 N PAX8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013952.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01832 pDONR223 100% 88.4% 72.8% None 896_897ins79;1194_1195ins77 n/a
2 ccsbBroad304_01832 pLX_304 0% 88.4% 72.8% V5 896_897ins79;1194_1195ins77 n/a
3 TRCN0000478651 AGCACCTCAACCCACTCTTGGTCG pLX_317 19.7% 88.4% 72.8% V5 896_897ins79;1194_1195ins77 n/a
4 TRCN0000489099 AAACTTCCGAGGCGCTCTATTTCC pLX_317 14.6% 88.4% 72.8% V5 (not translated due to prior stop codon) 896_897ins79;1194_1195ins77 n/a
5 TRCN0000489693 TTAGTAAGGTCGATCTATTGCCCA pLX_317 25.6% 88.3% 72.7% V5 896_897ins79;1194_1195ins78 n/a
Download CSV