Transcript: Mouse NM_011040.4

Mus musculus paired box 8 (Pax8), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Pax8 (18510)
Length:
2569
CDS:
199..1572

Additional Resources:

NCBI RefSeq record:
NM_011040.4
NBCI Gene record:
Pax8 (18510)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011040.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085778 CCTCACTGTAAATACCGTAAA pLKO.1 2374 3UTR 100% 10.800 15.120 N Pax8 n/a
2 TRCN0000426174 AGTCACACAAAGGAATCTTTA pLKO_005 1641 3UTR 100% 13.200 9.240 N Pax8 n/a
3 TRCN0000085781 CCACCCTGACATCTTCCAATA pLKO.1 1028 CDS 100% 10.800 7.560 N Pax8 n/a
4 TRCN0000021274 CCTTCGCCATAAAGCAGGAAA pLKO.1 1112 CDS 100% 4.950 3.465 N PAX8 n/a
5 TRCN0000085782 TGGCAATGACAACAAGAGAAA pLKO.1 771 CDS 100% 4.950 3.465 N Pax8 n/a
6 TRCN0000021276 CTCTTTATCTAGCTCCGCCTT pLKO.1 1167 CDS 100% 2.160 1.512 N PAX8 n/a
7 TRCN0000085779 CCTGCTGAGTTCTCCATATTA pLKO.1 1488 CDS 100% 15.000 9.000 N Pax8 n/a
8 TRCN0000085780 GCCTGCTGAGTTCTCCATATT pLKO.1 1487 CDS 100% 13.200 7.920 N Pax8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011040.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01832 pDONR223 100% 90% 96.7% None (many diffs) n/a
2 ccsbBroad304_01832 pLX_304 0% 90% 96.7% V5 (many diffs) n/a
3 TRCN0000478651 AGCACCTCAACCCACTCTTGGTCG pLX_317 19.7% 90% 96.7% V5 (many diffs) n/a
4 TRCN0000489099 AAACTTCCGAGGCGCTCTATTTCC pLX_317 14.6% 90% 96.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489693 TTAGTAAGGTCGATCTATTGCCCA pLX_317 25.6% 89.9% 96.5% V5 (many diffs) n/a
Download CSV