Construct: ORF TRCN0000478662
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015187.1_s317c1
- Derived from:
- ccsbBroadEn_10702
- DNA Barcode:
- CACACGTATGAAGCCAGTTTCTGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FMNL1 (752)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478662
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 752 | FMNL1 | formin like 1 | XM_006722070.4 | 41.8% | 41.7% | 1_1923del;3303_3304delCCinsAG |
2 | human | 752 | FMNL1 | formin like 1 | XM_006722066.4 | 41.6% | 41.5% | 1_1941del;3321_3322delCCinsAG |
3 | human | 752 | FMNL1 | formin like 1 | NM_005892.4 | 40.2% | 39.4% | (many diffs) |
4 | human | 752 | FMNL1 | formin like 1 | XM_011525182.3 | 40% | 39.2% | (many diffs) |
5 | human | 752 | FMNL1 | formin like 1 | XM_011525180.2 | 39.8% | 37.7% | (many diffs) |
6 | human | 752 | FMNL1 | formin like 1 | XM_006722065.4 | 39.3% | 37.3% | (many diffs) |
7 | human | 752 | FMNL1 | formin like 1 | XM_006722064.4 | 39.1% | 37.1% | (many diffs) |
8 | human | 752 | FMNL1 | formin like 1 | XM_006722063.4 | 39% | 36.9% | (many diffs) |
9 | human | 752 | FMNL1 | formin like 1 | XM_006722062.4 | 38.8% | 36.8% | (many diffs) |
10 | human | 752 | FMNL1 | formin like 1 | XM_011525179.3 | 38.8% | 36.8% | (many diffs) |
11 | human | 752 | FMNL1 | formin like 1 | XM_006722069.3 | 38.5% | 38.4% | 1_1941del;2908_2909ins102;3219_3220delCCinsAG |
12 | mouse | 57778 | Fmnl1 | formin-like 1 | XM_006533845.2 | 38.1% | 40.2% | (many diffs) |
13 | mouse | 57778 | Fmnl1 | formin-like 1 | XM_006533844.2 | 37.8% | 39.8% | (many diffs) |
14 | mouse | 57778 | Fmnl1 | formin-like 1 | NM_001077698.1 | 36.3% | 38.3% | (many diffs) |
15 | mouse | 57778 | Fmnl1 | formin-like 1 | XM_006533842.2 | 36.1% | 38% | (many diffs) |
16 | mouse | 57778 | Fmnl1 | formin-like 1 | XM_006533841.2 | 36% | 37.9% | (many diffs) |
17 | mouse | 57778 | Fmnl1 | formin-like 1 | XM_006533838.2 | 35.7% | 37.6% | (many diffs) |
18 | mouse | 57778 | Fmnl1 | formin-like 1 | XM_006533837.2 | 35.7% | 37.6% | (many diffs) |
19 | mouse | 57778 | Fmnl1 | formin-like 1 | XM_006533843.2 | 35.2% | 36.4% | (many diffs) |
20 | mouse | 57778 | Fmnl1 | formin-like 1 | NM_019679.2 | 35.1% | 36.3% | (many diffs) |
21 | mouse | 57778 | Fmnl1 | formin-like 1 | XM_006533840.2 | 34.6% | 35.7% | (many diffs) |
22 | mouse | 57778 | Fmnl1 | formin-like 1 | XM_006533839.2 | 34.5% | 35.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1455
- ORF length:
- 1389
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc actcttgaac tgggtggcac tgaaacccag ccagatcacc ggcactgtct 121 tcacagagct caatgatgag aaggtgctgc aggagctaga catgagtgat tttgaggaac 181 agttcaagac caagtcccaa ggccccagcc tggacctcag cgctctcaag agtaaggcag 241 cccagaaggc ccccagcaag gcgacactca ttgaggccaa ccgggccaag aacttggcca 301 tcaccctgcg gaagggcaac ctgggggccg agcgcatctg ccaagccatt gaggcgtacg 361 acctgcaggc tctgggcctg gacttcctgg agctgctgat gcgcttcctg cccacagagt 421 atgagcgcag cctcatcacc cgctttgagc gggagcagcg gccaatggag gagctgtcag 481 aggaggaccg cttcatgcta tgcttcagcc gcatcccgcg cctgccggag cgcatgacca 541 cactcacctt cctgggcaac ttcccggaca cagcccagct gctcatgccg caactgaatg 601 ccatcattgc agcctcaatg tccatcaagt cctctgacaa actccgccag atcctggaga 661 ttgtcctggc ctttggcaac tacatgaaca gtagcaagcg tggggcagcc tatggcttcc 721 ggctccagag cctggatgcg ctgttggaga tgaagtcgac tgatcgcaag cagacgctgc 781 tgcactacct ggtgaaggtc attgctgaga agtacccgca actcacaggc ttccacagcg 841 acctgcactt cctggacaag gcgggctcag tgtccctgga cagtgtcctg gcggacgtgc 901 gctccctgca gcgaggccta gagttgacac agagagagtt tgtgcggcag gatgactgca 961 tggtgctcaa ggagttcctg agggccaact cgcccaccat ggacaagctg ctggcagaca 1021 gcaagacggc tcaggaggcc tttGAGTCTG TGGTGGAGTA CTTCGGAGAG AACCCCAAGA 1081 CCACATCCCC AGGCCTGTTC TTCTCCCTCT TTAGCCGCTT CATTAAGGCC TACAAGAAAG 1141 CTGAGCAGGA GGTGGAACAG TGGAAAAAAG AAGCCGCTGC CCAGGAGGCA GGCGCTGATA 1201 CCCCGGGCAA AGGGGAGCCC CCAGCACCCA AGTCACCGCC AAAGGCCCGG CGGCCACAGA 1261 TGGACCTCAT CTCTGAGCTG AAACGGAGGC AGCAGAAGGA GCCACTCATT TATGAGAGCG 1321 ACCGTGATGG GGCCATTGAA GACATCATCA CAGATCTGCG GAACCAGCCC TACATCCGCG 1381 CAGACACAGG CCGCCGCAGT GCCCGTCGGC GTCCCCCGGG CCCCCCACTG CAGGTCACCT 1441 CCGAAGTCTC GCTGTACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1501 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1561 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA CACACGTATG AAGCCAGTTT 1621 CTGCACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt