Transcript: Mouse XM_006533841.2

PREDICTED: Mus musculus formin-like 1 (Fmnl1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fmnl1 (57778)
Length:
4365
CDS:
739..4050

Additional Resources:

NCBI RefSeq record:
XM_006533841.2
NBCI Gene record:
Fmnl1 (57778)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533841.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120520 AGGAACACTTTAAGACCAAAT pLKO.1 2783 CDS 100% 10.800 15.120 N Fmnl1 n/a
2 TRCN0000120521 GATCGCTCTAAGCCTTAACAA pLKO.1 1530 CDS 100% 5.625 7.875 N Fmnl1 n/a
3 TRCN0000120519 CCTAGAGATTGTCCTGGCTTT pLKO.1 3261 CDS 100% 4.050 3.240 N Fmnl1 n/a
4 TRCN0000008287 GAGCGGTTTCAAGTCAAGAAT pLKO.1 952 CDS 100% 5.625 3.938 N FMNL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533841.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10702 pDONR223 100% 36% 37.9% None (many diffs) n/a
2 ccsbBroad304_10702 pLX_304 0% 36% 37.9% V5 (many diffs) n/a
3 TRCN0000478662 CACACGTATGAAGCCAGTTTCTGC pLX_317 29.9% 36% 37.9% V5 (many diffs) n/a
Download CSV