Transcript: Human XM_006722062.4

PREDICTED: Homo sapiens formin like 1 (FMNL1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FMNL1 (752)
Length:
6078
CDS:
1858..5352

Additional Resources:

NCBI RefSeq record:
XM_006722062.4
NBCI Gene record:
FMNL1 (752)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006722062.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008289 CCCTCTTTAGCCGCTTCATTA pLKO.1 4838 CDS 100% 13.200 18.480 N FMNL1 n/a
2 TRCN0000008290 CACGTCTGTATTATGTGCCTA pLKO.1 2557 CDS 100% 2.640 3.696 N FMNL1 n/a
3 TRCN0000008288 CCATCCAGACTAAGTTCCGAA pLKO.1 3779 CDS 100% 2.640 3.696 N FMNL1 n/a
4 TRCN0000428674 CCGAAAGGTAGCAGCTGATTG pLKO_005 2148 CDS 100% 10.800 8.640 N FMNL1 n/a
5 TRCN0000414651 AGGCGTACCTGGACAATATTT pLKO_005 2999 CDS 100% 15.000 10.500 N FMNL1 n/a
6 TRCN0000008287 GAGCGGTTTCAAGTCAAGAAT pLKO.1 2071 CDS 100% 5.625 3.938 N FMNL1 n/a
7 TRCN0000008286 CCGCTATTTCTGCAGGTGGAT pLKO.1 5727 3UTR 100% 2.640 1.848 N FMNL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006722062.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10702 pDONR223 100% 38.8% 36.8% None (many diffs) n/a
2 ccsbBroad304_10702 pLX_304 0% 38.8% 36.8% V5 (many diffs) n/a
3 TRCN0000478662 CACACGTATGAAGCCAGTTTCTGC pLX_317 29.9% 38.8% 36.8% V5 (many diffs) n/a
Download CSV