Construct: ORF TRCN0000478823
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013968.1_s317c1
- Derived from:
- ccsbBroadEn_12191
- DNA Barcode:
- TTCCAAAATGACCAGCCAAATCGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- YY1AP1 (55249)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478823
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55249 | YY1AP1 | YY1 associated protein 1 | NM_139121.2 | 94.2% | 94.2% | 1_117del |
| 2 | human | 55249 | YY1AP1 | YY1 associated protein 1 | NM_001198899.1 | 87.2% | 87.2% | 1_282del |
| 3 | human | 55249 | YY1AP1 | YY1 associated protein 1 | NM_001198900.1 | 87.2% | 87.2% | 1_282del |
| 4 | human | 55249 | YY1AP1 | YY1 associated protein 1 | NM_018253.3 | 87.2% | 87.2% | 1_282del |
| 5 | human | 55249 | YY1AP1 | YY1 associated protein 1 | NM_001198901.1 | 86% | 86% | 1_315del |
| 6 | human | 55249 | YY1AP1 | YY1 associated protein 1 | NM_001198902.1 | 86% | 86% | 1_315del |
| 7 | human | 55249 | YY1AP1 | YY1 associated protein 1 | NM_139119.2 | 86% | 86% | 1_315del |
| 8 | human | 55249 | YY1AP1 | YY1 associated protein 1 | NM_001198905.1 | 83.3% | 83.3% | 1_315del;728_729ins60 |
| 9 | human | 55249 | YY1AP1 | YY1 associated protein 1 | NM_139118.2 | 76.5% | 76.5% | 1_513del;926_927ins60 |
| 10 | human | 55249 | YY1AP1 | YY1 associated protein 1 | NM_001198903.1 | 72.6% | 72.6% | 1_729del |
| 11 | human | 55249 | YY1AP1 | YY1 associated protein 1 | NM_001198904.1 | 70.3% | 70.3% | 1_729del;1142_1143ins60 |
| 12 | human | 54856 | GON4L | gon-4 like | NM_001282861.2 | 40.8% | 39.6% | (many diffs) |
| 13 | human | 54856 | GON4L | gon-4 like | NM_032292.6 | 40.8% | 39.6% | (many diffs) |
| 14 | human | 54856 | GON4L | gon-4 like | XM_005245286.3 | 33.4% | 32.3% | (many diffs) |
| 15 | human | 54856 | GON4L | gon-4 like | XM_005245284.3 | 30.2% | 29.3% | (many diffs) |
| 16 | human | 54856 | GON4L | gon-4 like | XM_011509659.2 | 30.2% | 29.3% | (many diffs) |
| 17 | human | 55249 | YY1AP1 | YY1 associated protein 1 | NM_001198906.2 | 29.9% | 27.7% | 1_513del;1193_1212del;1272_1273ins1196 |
| 18 | human | 54856 | GON4L | gon-4 like | NM_001282858.2 | 27.9% | 27% | (many diffs) |
| 19 | human | 54856 | GON4L | gon-4 like | XM_006711393.3 | 27.9% | 27% | (many diffs) |
| 20 | human | 54856 | GON4L | gon-4 like | XM_006711394.4 | 27.9% | 27% | (many diffs) |
| 21 | human | 54856 | GON4L | gon-4 like | NM_001282856.1 | 27.8% | 27% | (many diffs) |
| 22 | human | 54856 | GON4L | gon-4 like | NM_001282860.1 | 27.8% | 27% | (many diffs) |
| 23 | human | 54856 | GON4L | gon-4 like | XM_011509658.2 | 27.6% | 25.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2001
- ORF length:
- 1935
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca gcagcatgtt cagctcttga cacaaatcca ccttcttgcc acctgcaacc 121 ccaatctcaa tccggaggcc agtagcacca ggatatgtct taaagagctg ggaacctttg 181 ctcaaagctc catcgccctt caccatcagt acaaccccaa gtttcagacc ctgttccaac 241 cctgtaactt gatgggagct atgcagctga ttgaagactt cagcacacat gtcagcattg 301 actgcagccc tcataaaact gtcaagaaga ctgccaatga atttccctgt ttgccaaagc 361 aagtggcttg gatcctggcc acaagcaagg ttttcatgta tccagagtta cttccagtgt 421 gttccctgaa ggcaaagaat ccccaggata agatcctctt caccaaggct gaggacaatt 481 tgttagcttt aggactgaag cattttgaag ggactgagtt tcttaaccct ctaatcagca 541 agtaccttct aacctgcaag actgcccgcc aactgacagt gagaatcaag aacctcaaca 601 tgaacagagc tcctgacaac atcattaaat tttataagaa gaccaaacag ctgccagtcc 661 taggaaaatg ctgtgaagag atccagccac atcagtggaa gccacctata gagagagaag 721 aacaccggct cccattctgg ttaaaggcca gtctgccatc catccaggaa gaactgcggc 781 acatggctga tggtgctaga gaggtaggaa atatgactgg aaccactgag atcaactcag 841 atcaaggcct agaaaaagac aactcagagt tggggagtga aactcggtac ccactgctat 901 tgcctaaggg tgtagtcctg aaactgaagc cagttgccga ccgtttcccc aagaaggctt 961 ggagacagaa gcgttcatca gtcctgaaac ccctccttat ccaacccagc ccctctctcc 1021 agcccagctt caaccctggg aaaacaccag cccaatcaac tcattcagaa gcccctccga 1081 gcaaaatggt gctccggatt cctcacccaa tacagccagc cactgtttta cagacagttc 1141 caggtgtccc tccactgggg gtcagtggag gtgagagttt tgagtctcct gcagcactgc 1201 ctgctatgcc ccctgaggcc aggacaagct tccctctgtc tgagtcccag actttgctct 1261 cttctgcccc tgtgcccaag gtaatgatgc cctcccctgc ctcttccatg tttcgaaagc 1321 catatgtgag acggagaccc tcaaaaagaa ggggagccag ggcctttcgc tgtatcaaac 1381 ctgcccctgt tatccaccct gcatctgtta tcttcactgt tcctgctacc actgtgaaga 1441 ttgtgagcct tggcggtggc tgtaacatga tccagcctgt caatgcggct gtggcccaga 1501 gtccccagac tattcccatc gccaccctct tggttaaccc tacttccttc ccctgtccat 1561 tgaaccagcc ccttgtggcc tcctctgtct cacccttaat tgtttctggc aattctgtga 1621 aTCTTCCTAT ACCATCCACC CCTGAAGATA AGGCCCACAT GAATGTGGAC ATTGCTTGTG 1681 CTGTGGCTGA TGGGGAAAAT GCCTTTCAGG GCCTAGAACC CAAATTAGAG CCCCAGGAAC 1741 TATCTCCTCT CTCTGCTACT GTTTTCCCCA AAGTGGAACA TAGCCCAGGG CCTCCACCAG 1801 TCGATAAACA GTGCCAAGAA GGATTGTCAG AGAACAGTGC CTATCGCTGG ACCGTTGTGA 1861 AAACAGAGGA GGGAAGGCAA GCTCTGGAGC CGCTCCCTCA GGGCATCCAG GAGTCTCTAA 1921 ACAACTCTTC CCCTGGGGAT TTAGAGGAAG TTGTCAAGAT GGAACCTGAA GATGCTACAG 1981 AGGAAATCAG TGGATTTCTT TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 2041 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 2101 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGATTCC AAAATGACCA 2161 GCCAAATCGT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt