Transcript: Human NM_032292.6

Homo sapiens gon-4 like (GON4L), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
GON4L (54856)
Length:
5128
CDS:
83..4672

Additional Resources:

NCBI RefSeq record:
NM_032292.6
NBCI Gene record:
GON4L (54856)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032292.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240878 GATGAGGAGAGTGGCATATTA pLKO_005 1337 CDS 100% 15.000 21.000 N GON4L n/a
2 TRCN0000245368 GACCTAGAATCAGCCGTTAAA pLKO_005 161 CDS 100% 13.200 9.240 N GON4L n/a
3 TRCN0000240877 TGGAATATTTCACCAATTAAG pLKO_005 1109 CDS 100% 13.200 7.920 N GON4L n/a
4 TRCN0000134438 GCTCCTGACAACATCATTAAA pLKO.1 2708 CDS 100% 15.000 7.500 Y YY1AP1 n/a
5 TRCN0000285285 GCTCCTGACAACATCATTAAA pLKO_005 2708 CDS 100% 15.000 7.500 Y YY1AP1 n/a
6 TRCN0000133702 GCATCTGTTATCTTCACTGTT pLKO.1 3503 CDS 100% 4.950 2.475 Y YY1AP1 n/a
7 TRCN0000133891 CCCTTAATTGTTTCTGGCAAT pLKO.1 3695 CDS 100% 4.050 2.025 Y YY1AP1 n/a
8 TRCN0000135041 CTGAGGACAATTTGTTAGCTT pLKO.1 2568 CDS 100% 3.000 1.500 Y YY1AP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032292.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03562 pDONR223 100% 47.2% 45.6% None (many diffs) n/a
2 ccsbBroad304_03562 pLX_304 0% 47.2% 45.6% V5 (many diffs) n/a
3 TRCN0000480671 CTGAAGATAAAAGGAGGGATAAAT pLX_317 17.9% 47.2% 45.6% V5 (many diffs) n/a
4 ccsbBroadEn_08497 pDONR223 100% 46.5% 44.9% None (many diffs) n/a
5 ccsbBroad304_08497 pLX_304 0% 46.5% 44.9% V5 (many diffs) n/a
6 TRCN0000470020 ACATCCTCTCAAAATGCTGCGGTC pLX_317 17.4% 46.5% 44.9% V5 (many diffs) n/a
7 ccsbBroadEn_15890 pDONR223 0% 43.2% 41.8% None (many diffs) n/a
8 ccsbBroad304_15890 pLX_304 0% 43.2% 41.8% V5 (many diffs) n/a
9 ccsbBroadEn_12191 pDONR223 100% 40.8% 39.6% None (many diffs) n/a
10 ccsbBroad304_12191 pLX_304 0% 40.8% 39.6% V5 (many diffs) n/a
11 TRCN0000478823 TTCCAAAATGACCAGCCAAATCGT pLX_317 19.9% 40.8% 39.6% V5 (many diffs) n/a
Download CSV