Transcript: Human NM_001282860.1

Homo sapiens gon-4 like (GON4L), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
GON4L (54856)
Length:
7833
CDS:
176..6901

Additional Resources:

NCBI RefSeq record:
NM_001282860.1
NBCI Gene record:
GON4L (54856)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282860.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240878 GATGAGGAGAGTGGCATATTA pLKO_005 1430 CDS 100% 15.000 21.000 N GON4L n/a
2 TRCN0000240876 GCGAGAAGCCCTACAACATAT pLKO_005 5089 CDS 100% 13.200 18.480 N GON4L n/a
3 TRCN0000245368 GACCTAGAATCAGCCGTTAAA pLKO_005 254 CDS 100% 13.200 9.240 N GON4L n/a
4 TRCN0000180912 GCAAGGTCTGTGACAGCAAAT pLKO.1 5802 CDS 100% 10.800 7.560 N GON4L n/a
5 TRCN0000178779 CCATGAATCTCCATCAGGAAT pLKO.1 6457 CDS 100% 4.950 3.465 N GON4L n/a
6 TRCN0000180346 GCCACAGACCTTCAACATCAT pLKO.1 6697 CDS 100% 4.950 3.465 N GON4L n/a
7 TRCN0000240879 ACCTGTAGATGGATGATTATT pLKO_005 7586 3UTR 100% 15.000 9.000 N GON4L n/a
8 TRCN0000240877 TGGAATATTTCACCAATTAAG pLKO_005 1202 CDS 100% 13.200 7.920 N GON4L n/a
9 TRCN0000134438 GCTCCTGACAACATCATTAAA pLKO.1 2801 CDS 100% 15.000 7.500 Y YY1AP1 n/a
10 TRCN0000285285 GCTCCTGACAACATCATTAAA pLKO_005 2801 CDS 100% 15.000 7.500 Y YY1AP1 n/a
11 TRCN0000133702 GCATCTGTTATCTTCACTGTT pLKO.1 3596 CDS 100% 4.950 2.475 Y YY1AP1 n/a
12 TRCN0000133891 CCCTTAATTGTTTCTGGCAAT pLKO.1 3788 CDS 100% 4.050 2.025 Y YY1AP1 n/a
13 TRCN0000135041 CTGAGGACAATTTGTTAGCTT pLKO.1 2661 CDS 100% 3.000 1.500 Y YY1AP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282860.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03562 pDONR223 100% 32.2% 31.1% None (many diffs) n/a
2 ccsbBroad304_03562 pLX_304 0% 32.2% 31.1% V5 (many diffs) n/a
3 TRCN0000480671 CTGAAGATAAAAGGAGGGATAAAT pLX_317 17.9% 32.2% 31.1% V5 (many diffs) n/a
4 ccsbBroadEn_08497 pDONR223 100% 31.7% 30.6% None (many diffs) n/a
5 ccsbBroad304_08497 pLX_304 0% 31.7% 30.6% V5 (many diffs) n/a
6 TRCN0000470020 ACATCCTCTCAAAATGCTGCGGTC pLX_317 17.4% 31.7% 30.6% V5 (many diffs) n/a
7 ccsbBroadEn_15890 pDONR223 0% 29.4% 28.5% None (many diffs) n/a
8 ccsbBroad304_15890 pLX_304 0% 29.4% 28.5% V5 (many diffs) n/a
9 ccsbBroadEn_12191 pDONR223 100% 27.8% 27% None (many diffs) n/a
10 ccsbBroad304_12191 pLX_304 0% 27.8% 27% V5 (many diffs) n/a
11 TRCN0000478823 TTCCAAAATGACCAGCCAAATCGT pLX_317 19.9% 27.8% 27% V5 (many diffs) n/a
Download CSV