Construct: ORF TRCN0000478921
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009122.1_s317c1
- Derived from:
- ccsbBroadEn_03559
- DNA Barcode:
- TACTTAACGGTGTTCCCTGAATTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KIRREL1 (55243)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478921
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 55243 | KIRREL1 | kirre like nephrin family a... | NM_018240.7 | 100% | 100% | |
2 | human | 55243 | KIRREL1 | kirre like nephrin family a... | XM_005245305.5 | 97.9% | 97.9% | 1044_1091del |
3 | human | 55243 | KIRREL1 | kirre like nephrin family a... | NM_001286349.1 | 86.7% | 86.6% | 52_53ins300 |
4 | mouse | 170643 | Kirrel | kin of IRRE like (Drosophila) | XM_006501076.3 | 86.1% | 93.9% | (many diffs) |
5 | mouse | 170643 | Kirrel | kin of IRRE like (Drosophila) | NM_001170985.1 | 84.6% | 90.9% | (many diffs) |
6 | mouse | 170643 | Kirrel | kin of IRRE like (Drosophila) | NM_130867.3 | 84.6% | 90.9% | (many diffs) |
7 | mouse | 170643 | Kirrel | kin of IRRE like (Drosophila) | XM_011240028.2 | 82.9% | 89.1% | (many diffs) |
8 | mouse | 170643 | Kirrel | kin of IRRE like (Drosophila) | XM_011240029.1 | 82.9% | 89.1% | (many diffs) |
9 | mouse | 170643 | Kirrel | kin of IRRE like (Drosophila) | XM_017319471.1 | 79.6% | 87% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2340
- ORF length:
- 2271
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gctgagcctc ctcgtctgga tcctcactct ctccgatact ttctcccaag 121 ggacccagac ccgcttcagc caggagccag ctgaccagac ggtggtggct ggacagcggg 181 ccgtgctccc ctgtgtgctg ctcaactact ctggaattgt gcaatggacc aaggacgggc 241 tggccctggg catgggccag ggcctcaaag cctggccacg gtaccgggtt gtgggctccg 301 cagacgctgg gcagtacaac ctggagatca cagatgctga gctctctgac gacgcctctt 361 acgagtgcca ggccacggag gccgccctgc gctctcggcg ggccaaactc accgtgctca 421 tccccccaga ggacaccagg attgacggag gccctgtgat tctactgcag gcaggcaccc 481 cccacaacct cacatgccgg gccttcaatg cgaagcctgc tgccaccatc atctggttcc 541 gggacgggac gcagcaggag ggcgctgtgg ccagcacgga attgctgaag gatgggaaga 601 gggagaccac cgtgagccaa ctgcttatta accccacgga cctggacata gggcgtgtct 661 tcacttgccg aagcatgaac gaagccatcc ctagtggcaa ggagacttcc atcgagctgg 721 atgtgcacca ccctcctaca gtgaccctgt ccattgagcc acagacggtg caggagggtg 781 agcgtgttgt ctttacctgc caggccacag ccaaccccga gatcttgggc tacaggtggg 841 ccaaaggggg tttcttgatt gaagacgccc acgagagtcg ctatgagaca aatgtggatt 901 attccttttt cacggagcct gtgtcttgtg aggttcacaa caaagtggga agcaccaatg 961 tcagcacttt agtaaatgtc cactttgctc cccggattgt agttgacccc aaacccacaa 1021 ccacagacat tggctctgat gtgaccctta cctgtgtctg ggttgggaat ccccccctca 1081 ctctcacctg gaccaaaaag gactcaaata tggtcctgag taacagcaac cagctgctgc 1141 tgaagtcggt gactcaggca gacgctggca cctacacctg ccgggccatc gtgcctcgaa 1201 tcggagtggc tgagcgggag gtgccgctct atgtgaacgg gccccccatc atctccagtg 1261 aggcagtgca gtatgctgtg aggggtgacg gtggcaaggt ggagtgtttc attgggagca 1321 caccaccccc agaccgcata gcatgggcct ggaaggagaa cttcttggag gtggggaccc 1381 tggaacgcta tacagtggag aggaccaact caggcagtgg ggtgctatcc acgctcacca 1441 tcaacaatgt catggaggcc gactttcaga ctcactacaa ctgcaccgcc tggaacagct 1501 tcgggccagg cacagccatc atccagctgg aagagcgaga ggtgttacct gtgggcatca 1561 tagctggggc caccatcggc gcgagcatcc tgctcatctt cttcttcatc gccttggtat 1621 tcttcctcta ccggcgccgc aaaggcagtc gcaaagacgt gaccctgagg aagctggata 1681 tcaaggtgga gacagtgaac cgagagccac ttacgatgca ttctgaccgg gaggatgaca 1741 ccgccagcgt ctccacagca acccgggtca tgaaggccat ctactcgtcg tttaaggatg 1801 atgtggatct gaagcaggac ctgcgctgcg acaccatcga cacccgggag gagtatgaga 1861 tgaaggaccc caccaatggc tactacaacg tgcgtgccca tgaagaccgc ccgtcttcca 1921 gggcagtgct ctatgctgac taccgtgccc ctggccctgc ccgcttcgac ggccgcccct 1981 catcccgtct ctccCACTCC AGCGGCTATG CCCAGCTCAA CACCTATAGC CGGGGCCCTG 2041 CCTCTGACTA TGGCCCTGAG CCCACACCCC CTGGCCCTGC TGCCCCAGCT GGCACTGACA 2101 CAACCAGCCA GCTGTCCTAC GAGAACTATG AGAAGTTCAA CTCCCATCCC TTCCCTGGGG 2161 CAGCTGGGTA CCCCACCTAC CGACTGGGCT ACCCCCAGGC CCCACCCTCT GGCCTGGAGC 2221 GGACCCCATA TGAGGCGTAT GACCCCATTG GCAAGTACGC CACAGCCACT CGATTCTCCT 2281 ACACCTCCCA GCACTCGGAC TACGGCCAGC GATTCCAGCA GCGCATGCAG ACTCACGTGT 2341 TGCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 2401 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 2461 TTTATATATC TTGTGGAAAG GACGATACTT AACGGTGTTC CCTGAATTGA CGCGTTAAGT 2521 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt