Transcript: Mouse NM_130867.3

Mus musculus kin of IRRE like (Drosophila) (Kirrel), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Kirrel (170643)
Length:
7284
CDS:
363..2732

Additional Resources:

NCBI RefSeq record:
NM_130867.3
NBCI Gene record:
Kirrel (170643)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_130867.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094580 CCCGGATTGTAGTTTACCCAA pLKO.1 1381 CDS 100% 2.640 3.696 N Kirrel n/a
2 TRCN0000094581 CCACACTTAGTCGTTGCTTAT pLKO.1 456 CDS 100% 10.800 7.560 N Kirrel n/a
3 TRCN0000094582 CCCACCAATGGTTATTACAAT pLKO.1 2259 CDS 100% 5.625 3.938 N Kirrel n/a
4 TRCN0000094583 GCTCACCATTAATAATGTCAT pLKO.1 1823 CDS 100% 4.950 3.465 N Kirrel n/a
5 TRCN0000094579 TCCCTGACATTCAGGGACATT pLKO.1 2789 3UTR 100% 0.495 0.347 N Kirrel n/a
6 TRCN0000146273 CGAGAACTATGAGAAGTTCAA pLKO.1 2510 CDS 100% 0.495 0.297 N KIRREL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_130867.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03559 pDONR223 100% 84.6% 90.9% None (many diffs) n/a
2 ccsbBroad304_03559 pLX_304 0% 84.6% 90.9% V5 (many diffs) n/a
3 TRCN0000478921 TACTTAACGGTGTTCCCTGAATTG pLX_317 15.5% 84.6% 90.9% V5 (many diffs) n/a
Download CSV