Transcript: Human NM_018240.7

Homo sapiens kirre like nephrin family adhesion molecule 1 (KIRREL1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
KIRREL1 (55243)
Length:
7448
CDS:
33..2306

Additional Resources:

NCBI RefSeq record:
NM_018240.7
NBCI Gene record:
KIRREL1 (55243)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018240.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147545 GCTATGAGACAAATGTGGATT pLKO.1 844 CDS 100% 4.950 6.930 N KIRREL1 n/a
2 TRCN0000426204 AGGGTGAGCGTGTTGTCTTTA pLKO_005 739 CDS 100% 13.200 9.240 N KIRREL1 n/a
3 TRCN0000425375 GGCCATCTACTCGTCGTTTAA pLKO_005 1739 CDS 100% 13.200 9.240 N KIRREL1 n/a
4 TRCN0000443630 AGTGAACCGAGAGCCACTTAC pLKO_005 1658 CDS 100% 10.800 7.560 N KIRREL1 n/a
5 TRCN0000442916 CCACGCTCACCATCAACAATG pLKO_005 1393 CDS 100% 10.800 7.560 N KIRREL1 n/a
6 TRCN0000148747 CTTCTTCATCGCCTTGGTATT pLKO.1 1565 CDS 100% 10.800 7.560 N KIRREL1 n/a
7 TRCN0000148315 CGACTTTCAGACTCACTACAA pLKO.1 1424 CDS 100% 4.950 3.465 N KIRREL1 n/a
8 TRCN0000146273 CGAGAACTATGAGAAGTTCAA pLKO.1 2084 CDS 100% 0.495 0.347 N KIRREL1 n/a
9 TRCN0000148726 CATCTTCTTCTTCATCGCCTT pLKO.1 1559 CDS 100% 2.160 1.296 N KIRREL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018240.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03559 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03559 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478921 TACTTAACGGTGTTCCCTGAATTG pLX_317 15.5% 100% 100% V5 n/a
Download CSV