Construct: ORF TRCN0000479065
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007019.1_s317c1
- Derived from:
- ccsbBroadEn_07199
- DNA Barcode:
- CTGAAGCACGAAGCTAGGCAGTTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- USP5 (8078)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479065
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 8078 | USP5 | ubiquitin specific peptidase 5 | NM_003481.3 | 99.9% | 99.8% | 2500G>A |
2 | human | 8078 | USP5 | ubiquitin specific peptidase 5 | NM_001098536.2 | 97.2% | 97% | 1886_1954del;2569G>A |
3 | human | 8078 | USP5 | ubiquitin specific peptidase 5 | XR_001748873.2 | 79.5% | (many diffs) | |
4 | human | 8078 | USP5 | ubiquitin specific peptidase 5 | XR_931527.3 | 77.8% | (many diffs) | |
5 | mouse | 22225 | Usp5 | ubiquitin specific peptidas... | NM_001326594.1 | 91.7% | 98.3% | (many diffs) |
6 | mouse | 22225 | Usp5 | ubiquitin specific peptidas... | NM_013700.2 | 89.2% | 95.5% | (many diffs) |
7 | mouse | 22225 | Usp5 | ubiquitin specific peptidas... | XM_006505916.3 | 84.3% | 90.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2571
- ORF length:
- 2505
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggagctgagt gaggaggcgc tgctgtcagt attaccgacg atccgggtcc 121 ctaaggctgg agaccgggtc cacaaagacg agtgcgcctt ctccttcgac acgccggagt 181 ctgagggggg cctctacatc tgtatgaaca cgtttctggg ctttgggaaa cagtatgtgg 241 agagacattt caataagacc ggccagcgag tctacttgca cctccggcgg acccggcgcc 301 cgaaagagga ggaccctgct acaggcactg gagacccacc ccggaagaag cccacgcggc 361 tggctattgg tgttgaaggc ggatttgacc ttagcgagga gaagtttgaa ttagacgagg 421 atgtgaagat tgtcattttg ccagattacc tggagattgc ccgggatgga ctggggggac 481 tgcctgacat tgtcagagat cgggtgacca gtgcagtgga ggccctactg tcggccgact 541 cagcctcccg caagcaggag gtgcaggcat gggatgggga agtacggcag gtgtctaagc 601 atgccttcag cctcaagcag ttggacaacc ctgctcgaat ccctccctgt ggctggaagt 661 gctccaagtg tgacatgaga gagaacctgt ggctcaacct gactgatggc tccatcctct 721 gtgggcgacg ctacttcgat ggcagtgggg gcaacaacca cgctgtggag cactaccgag 781 agacaggcta cccgttagct gtcaagctgg gcaccatcac ccctgatgga gctgacgtgt 841 actcatatga tgaggatgac atggtcctgg accccagcct ggctgagcac ctgtcccact 901 tcggcatcga catgctgaag atgcagaaga cagacaagac gatgactgag ttggagatag 961 acatgaacca gcggattggt gaatgggagc tgatccagga gtcaggtgtg ccactcaagc 1021 ccctgtttgg gcctggctac acaggcatcc ggaacctggg taacagctgc tacctcaact 1081 ctgtggtcca ggtgctcttc agcatccctg acttccagag gaagtatgtg gataagctgg 1141 agaagatctt ccagaatgcc ccgacggacc ctacccagga tttcagcacc caggtggcca 1201 agctgggcca tggccttctc tccggggagt attccaagcc agtaccggag tcgggcgatg 1261 gggagcgggt gccagaacag aaggaagttc aagatggcat tgcccctcgg atgttcaagg 1321 ccctcatcgg caagggccac cctgaattct ccaccaaccg gcagcaggat gcccaggagt 1381 tcttccttca ccttatcaac atggtggaga ggaattgccg gagctctgaa aatcctaatg 1441 aagtgttccg cttcttggtg gaggaaaaga tcaagtgcct ggccacagag aaggtgaagt 1501 acacccagcg agttgactac atcatgcagc tgcctgtgcc catggatgca gcccttaaca 1561 aagaggagct tctggagtac gaggagaaga agcggcaagc cgaagaggag aagatggcac 1621 tgccagaact ggttcgggcc caggtgccct tcagctcttg cctggaggcc tacggggccc 1681 ctgagcaggt cgatgacttc tggagcacgg ccctgcaggc caagtcagta gctgtcaaga 1741 ccacacgatt tgcctcattc cctgactacc tggtcatcca gatcaagaag ttcaccttcg 1801 gcttagactg ggtgcccaag aaactggatg tgtccatcga gatgccagag gagctcgaca 1861 tctcccagtt gaggggcaca gggctgcagc ccggagagga ggagctgcca gacattgccc 1921 cacccctggt cactccggat gagcccaaag cgcccatgct ggatgaatca gtcatcatcc 1981 agctggtgga gatgggattc cctatggacg cctgccgcaa agctgtctac tacacgggca 2041 acagcggggc tgaggccgcc atgaactggg tcatgtcaca catggatgat ccagattttg 2101 caaaccccct catcctgcct ggctctagtg ggccgggctc cacaagcgca gcagccgacc 2161 cccctcctGA GGACTGTGTG ACCACCATTG TCTCCATGGG CTTCTCCCGG GACCAGGCCT 2221 TGAAAGCGCT GCGGGCCACG AACAATAGTT TAGAACGGGC TGTGGACTGG ATCTTCAGTC 2281 ACATTGACGA CCTGGATGCT GAAGCTGCCA TGGACATCTC AGAGGGCCGC TCAGCTGCCG 2341 ACTCCATCTC TGAGTCTGTG CCAGTGGGAC CTAAAGTCCG GGATGGTCCT GGAAAGTATC 2401 AGCTCTTTGC CTTCATTAGT CACATGGGCA CCTCTACCAT GTGTGGTCAC TACGTCTGCC 2461 ACATCAAGAA AGAAGGCAGA TGGGTGATCT ACAATGACCA GAAAGTGTGT GCCTCCGAGA 2521 AGCCGCCCAA GGACCTGGGC TACATCTACT TCTACCAGAG AGTGACCAGC TACCCAACTT 2581 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 2641 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 2701 CTTGTGGAAA GGACGACTGA AGCACGAAGC TAGGCAGTTT ACGCGTTAAG TCgacaatca 2761 acctctggat tacaaaattt gtgaaagatt