Transcript: Human NM_003481.3

Homo sapiens ubiquitin specific peptidase 5 (USP5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
USP5 (8078)
Length:
3093
CDS:
31..2538

Additional Resources:

NCBI RefSeq record:
NM_003481.3
NBCI Gene record:
USP5 (8078)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003481.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306799 CGGGCCACGAACAATAGTTTA pLKO_005 2197 CDS 100% 13.200 18.480 N USP5 n/a
2 TRCN0000030738 CGAGGATGTGAAGATTGTCAT pLKO.1 381 CDS 100% 4.950 6.930 N Usp5 n/a
3 TRCN0000288462 CGAGGATGTGAAGATTGTCAT pLKO_005 381 CDS 100% 4.950 6.930 N Usp5 n/a
4 TRCN0000004067 CGGCTGGCTATTGGTGTTGAA pLKO.1 322 CDS 100% 4.950 6.930 N USP5 n/a
5 TRCN0000004069 GACCACACGATTTGCCTCATT pLKO.1 1704 CDS 100% 4.950 6.930 N USP5 n/a
6 TRCN0000004070 AGCGAGGAGAAGTTTGAATTA pLKO.1 358 CDS 100% 13.200 10.560 N USP5 n/a
7 TRCN0000293541 AGGATGTGAAGATTGTCATTT pLKO_005 383 CDS 100% 13.200 9.240 N USP5 n/a
8 TRCN0000293540 CCTGTCTGTAAGGAGACTTTG pLKO_005 2760 3UTR 100% 10.800 7.560 N USP5 n/a
9 TRCN0000030737 CCTGGGCTACATCTACTTCTA pLKO.1 2499 CDS 100% 4.950 3.465 N Usp5 n/a
10 TRCN0000288536 CCTGGGCTACATCTACTTCTA pLKO_005 2499 CDS 100% 4.950 3.465 N Usp5 n/a
11 TRCN0000004068 GATAGACATGAACCAGCGGAT pLKO.1 921 CDS 100% 2.160 1.512 N USP5 n/a
12 TRCN0000293539 GATAGACATGAACCAGCGGAT pLKO_005 921 CDS 100% 2.160 1.512 N USP5 n/a
13 TRCN0000004066 CTTTGCCTTCATTAGTCACAT pLKO.1 2370 CDS 100% 4.950 2.970 N USP5 n/a
14 TRCN0000293604 CTTTGCCTTCATTAGTCACAT pLKO_005 2370 CDS 100% 4.950 2.970 N USP5 n/a
15 TRCN0000030735 CCCTTAACAAAGAGGAGCTTT pLKO.1 1517 CDS 100% 4.950 3.465 N Usp5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003481.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07199 pDONR223 100% 99.9% 99.8% None 2500G>A n/a
2 ccsbBroad304_07199 pLX_304 0% 99.9% 99.8% V5 2500G>A n/a
3 TRCN0000479065 CTGAAGCACGAAGCTAGGCAGTTT pLX_317 16.3% 99.9% 99.8% V5 2500G>A n/a
Download CSV