Transcript: Mouse NM_013700.2

Mus musculus ubiquitin specific peptidase 5 (isopeptidase T) (Usp5), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Usp5 (22225)
Length:
3233
CDS:
90..2666

Additional Resources:

NCBI RefSeq record:
NM_013700.2
NBCI Gene record:
Usp5 (22225)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013700.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030736 CGAATGTTCAAGGCCCTCATT pLKO.1 1332 CDS 100% 4.950 6.930 N Usp5 n/a
2 TRCN0000293541 AGGATGTGAAGATTGTCATTT pLKO_005 442 CDS 100% 13.200 9.240 N USP5 n/a
3 TRCN0000295781 CCGGAAAGCTGTGTACTATAC pLKO_005 2108 CDS 100% 10.800 7.560 N Usp5 n/a
4 TRCN0000295722 TGGACGAATCCGTCATCATAC pLKO_005 2053 CDS 100% 10.800 7.560 N Usp5 n/a
5 TRCN0000030735 CCCTTAACAAAGAGGAGCTTT pLKO.1 1576 CDS 100% 4.950 3.465 N Usp5 n/a
6 TRCN0000030737 CCTGGGCTACATCTACTTCTA pLKO.1 2627 CDS 100% 4.950 3.465 N Usp5 n/a
7 TRCN0000288536 CCTGGGCTACATCTACTTCTA pLKO_005 2627 CDS 100% 4.950 3.465 N Usp5 n/a
8 TRCN0000030738 CGAGGATGTGAAGATTGTCAT pLKO.1 440 CDS 100% 4.950 3.465 N Usp5 n/a
9 TRCN0000288462 CGAGGATGTGAAGATTGTCAT pLKO_005 440 CDS 100% 4.950 3.465 N Usp5 n/a
10 TRCN0000004066 CTTTGCCTTCATTAGTCACAT pLKO.1 2498 CDS 100% 4.950 3.465 N USP5 n/a
11 TRCN0000293604 CTTTGCCTTCATTAGTCACAT pLKO_005 2498 CDS 100% 4.950 3.465 N USP5 n/a
12 TRCN0000030734 CCCTTAAGTGTTTGCTCCCTT pLKO.1 3054 3UTR 100% 2.640 1.848 N Usp5 n/a
13 TRCN0000004068 GATAGACATGAACCAGCGGAT pLKO.1 980 CDS 100% 2.160 1.512 N USP5 n/a
14 TRCN0000293539 GATAGACATGAACCAGCGGAT pLKO_005 980 CDS 100% 2.160 1.512 N USP5 n/a
15 TRCN0000295721 ATGTGGCTTTATGCATCTTTC pLKO_005 3004 3UTR 100% 10.800 6.480 N Usp5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013700.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07199 pDONR223 100% 89.2% 95.5% None (many diffs) n/a
2 ccsbBroad304_07199 pLX_304 0% 89.2% 95.5% V5 (many diffs) n/a
3 TRCN0000479065 CTGAAGCACGAAGCTAGGCAGTTT pLX_317 16.3% 89.2% 95.5% V5 (many diffs) n/a
Download CSV